Please see the attachments and answer the questions listed there about Chapter 2 of my textbook.
– Write the answers to a Word file
– You do not have to follow APA format but please add any references.
ITS-632Intro to Data Mining
Dr. Oner Celepcikay
Dept. of Information Technology &
School of Computer and Information Sciences
University of the Cumberlands
Chapter 2 Assignment
1. What’s noise? How can noise be reduced in a dataset?
2. Define outlier. Describe 2 different approaches to detect outliers in a dataset.
3. Give 2 examples in which aggregation is useful.
4. What’s stratified sampling? Why is it preferred?
5. Provide a brief description of what Principal Components Analysis (PCA) does. [Hint: See
Appendix A and your lecture notes.] State what’s the input and what the output of PCA is.
6. What’s the difference between dimensionality reduction and feature selection?
7. What’s the difference between feature selection and feature extraction?
8. Give two examples of data in which feature extraction would be useful.
9. What’s data discretization and when is it needed?
10. How are the Correlation and Covariance, used in data pre-processing (see pp. 76-78).
©Tan,St
e
inbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Dr. Oner Celepcikay
ITS 63
2
Data Mining
Summer 2019Week 3: Data and Data Exploration
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Chapter 2: Data
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
What is Data?
● Collection of data objects and
their attributes
● An attribute is a property or
characteristic of an object
– Examples: eye color of a
person, temperature, etc.
– Attribute is also known as
variable, field, characteristic,
or feature
● A collection of attributes
describe an object
– Object is also known as
record, point, case, sample,
entity, or instance
Tid Refund Marital
Status
Taxable
Income Cheat
1 Yes Single 125K No
2 No Married 100K No
3 No Single 70K No
4 Yes Married 120K No
5 No Divorced 95K Yes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K Yes
9 No Married 75K No
10 No Single 90K Yes
10
Attributes
Objects
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Attribute Values
● Attribute values are numbers or symbols assigned
to an attribute
● Distinction between attributes and attribute values
– Same attribute can be mapped to different attribute
values
u Example: height can be measured in feet or meters
– Different attributes can be mapped to the same set of
values
u Example: Attribute values for ID and age are integers
u But properties of attribute values can be different
– ID has no limit but age has a maximum and minimum value
– Some operations are meaningful on age but meaningless on ID
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Types of Attributes
● There are different types of attributes
– Nominal
u Examples: ID numbers, eye color, zip codes
– Ordinal
u Examples: rankings (e.g., taste of potato chips on a scale
from 1-10), grades, height in {tall, medium, short}
– Interval
u Examples: calendar dates, temperatures in Celsius or
Fahrenheit.
– Ratio
u Examples: temperature in Kelvin, length, time, counts
Attribute
Type
Description Examples Operations
Nominal The values of a nominal attribute are
just different names, i.e., nominal
attributes provide only enough
information to distinguish one object
from another. (=, ¹)
zip codes, employee
ID numbers, eye color,
sex: {male, female}
mode, entropy,
contingency
correlation, c2 test
Ordinal The values of an ordinal attribute
provide enough information to order
objects. (<, >)
hardness of minerals,
{good, better, best},
grades, street numbers
median, percentiles,
rank correlation,
run tests, sign tests
Interval For interval attributes, the
differences between values are
meaningful, i.e., a unit of
measurement exists.
(+, – )
calendar dates,
temperature in Celsius
or Fahrenheit
mean, standard
deviation, Pearson’s
correlation, t and F
tests
Ratio For ratio variables, both differences
and ratios are meaningful. (*, /)
temperature in Kelvin,
monetary quantities,
counts, age, mass,
length, electrical
current
geometric mean,
harmonic mean,
percent variation
Attribute
Level
Transformation Comments
Nominal Any permutation of values If all employee ID numbers
were reassigned, would it
make any difference?
Ordinal An order preserving change of
values, i.e.,
new_value = f(old_value)
where f is a monotonic function.
An attribute encompassing
the notion of good, better
best can be represented
equally well by the values
{1, 2, 3} or by { 0.5, 1,
10}.
Interval new_value =a * old_value + b
where a and b are constants
Thus, the Fahrenheit and
Celsius temperature scales
differ in terms of where
their zero value is and the
size of a unit (degree).
Ratio new_value = a * old_value Length can be measured in
meters or feet.
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Properties of Attribute Values
● The type of an attribute depends on which of the
following properties it possesses:
– Distinctness: = ¹
– Order: < >
– Addition: + –
– Multiplication: * /
– Nominal attribute: distinctness
– Ordinal attribute: distinctness & order
– Interval attribute: distinctness, order & addition
– Ratio attribute: all 4 properties
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Discrete and Continuous Attributes
● Discrete Attribute
– Has only a finite or countably infinite set of values
– Examples: zip codes, counts, or the set of words in a collection of
documents
– Often represented as integer
variables.
– Note: binary attributes are a special case of discrete attributes
● Continuous Attribute
– Has real numbers as attribute values
– Examples: temperature, height, or weight.
– Practically, real values can only be measured and represented
using a finite number of digits.
– Continuous attributes are typically represented as floating-point
variables.
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Types of data sets
● Record
– Data Matrix
–
Document Data
–
Transaction Data
● Graph
– World Wide Web
– Molecular Structures
● Ordered
– Spatial Data
– Temporal Data
– Sequential Data
– Genetic Sequence Data
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Important Characteristics of Structured Data
– Dimensionality
u
Curse of Dimensionality
– Sparsity
u Only presence counts
– Resolution
u Patterns depend on the scale
– Examples: Texas data, Aleks, Simpson’s Paradox
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Record Data
● Data that consists of a collection of records, each
of which consists of a fixed set of attributes
Tid Refund Marital
Status
Taxable
Income Cheat
1 Yes Single 125K No
2 No Married 100K No
3 No Single 70K No
4 Yes Married 120K No
5 No Divorced 95K Yes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K Yes
9 No Married 75K No
10 No Single 90K Yes
10
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Data Matrix
● If data objects have the same fixed set of numeric
attributes, then the data objects can be thought of as
points in a multi-dimensional space, where each
dimension represents a distinct attribute
● Such data set can be represented by an m by n matrix,
where there are m rows, one for each object, and n
columns, one for each attribute
1.12.216.226.2512.6
5
1.22.715.225.2710.2
3
Thickness LoadDistanceProjection
of y load
Projection
of x Load
1.12.216.226.2512.65
1.22.715.225.2710.23
Thickness LoadDistanceProjection
of y load
Projection
of x Load
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Document Data
● Each document becomes a `term’ vector,
– each term is a component (attribute) of the vector,
– the value of each component is the number of times the
corresponding term occurs in the document.
– In practice only non-0 is stored
Document
1
season
tim
eout
lost
w
in
gam
e
score
ball
play
coach
team
Document 2
Document 3
3 0 5 0 2 6 0 2 0 2
0
0
7 0 2 1 0 0 3 0 0
1 0 0 1 2 2 0 3 0
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Transaction Data
● A special type of record data, where
– each record (transaction) involves a set of items.
– For example, consider a grocery store. The set of
products purchased by a customer during one
shopping trip constitute a transaction, while the
individual products that were purchased are the items.
TID Items
1 Bread, Coke, Milk
2 Beer, Bread
3 Beer, Coke, Diaper, Milk
4 Beer, Bread, Diaper, Milk
5 Coke, Diaper, Milk
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Graph Data
● Examples: Generic graph and HTML Links
● Data objects are nodes, links are properties
5
2
1
2
5
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Chemical Data
● Benzene Molecule: C6H6
● Nodes are atoms, links are chemical bonds
● helps to identify substructures.
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Ordered Data
● Sequences of transactions
An element of
the sequence
Items/Events
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Ordered Data
● Genomic sequence data
● Similar to sequential data but no time stamps
GGTTCCGCCTTCAGCCCCGCGCC
CGCAGGGCCCGCCCCGCGCCGTC
GAGAAGGGCCCGCCTGGCGGGCG
GGGGGAGGCGGGGCCGCCCGAGC
CCAACCGAGTCCGACCAGGTGCC
CCCTCTGCTCGGCCTAGACCTGA
GCTCATTAGGCGGCAGCGGACAG
GCCAAGTAGAACACGCGAAGCGC
TGGGCTGCCTGCTGCGACCAGGG
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Ordered Data
● Spatio-Temporal Data
Average Monthly
Temperature of
land and ocean
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Data Quality
● What kinds of data quality problems?
● How can we detect problems with the data?
● What can we do about these problems?
● Examples of data quality problems:
– Noise and outliers
– missing values
– duplicate data
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Data Quality
● Precision: The closeness of repeated measurements (of
the same quantity) to other measurements.
● Bias: A systematic variation of measurements from the
quantity being measured.
● Accuracy: The closeness of measurements to the true
value of the quantity being measurement.
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Noise
● Noise refers to modification of original values
– Examples: distortion of a person�s voice when talking
on a poor phone and �snow� on television screen
Two Sine Waves Two Sine Waves + Noise
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Outliers
● Outliers are data objects with characteristics that
are considerably different than most of the other
data objects in the data set (diff. than noise)
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Missing Values
● Reasons for missing values
– Information is not collected
(e.g., people decline to give their age and weight)
– Attributes may not be applicable to all cases
(e.g., annual income is not applicable to children)
● Handling missing values
– Eliminate Data Objects (unless many missing)
– Estimate Missing Values (avg., most common val.)
– Ignore the Missing Value During Analysis
– Replace with all possible values (weighted by their
probabilities)
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Duplicate Data
● Data set may include data objects that are
duplicates, or almost duplicates of one another
– Major issue when merging data from heterogeous
sources
– Also attention needed to avoid combining 2 very
similar objects into 1.
● Examples:
– Same person with multiple email addresses
● Data cleaning
– Process of dealing with duplicate data issues
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Data Preprocessing
●
Aggregation
● Sampling
●
Dimensionality Reduction
● Feature subset selection
● Feature creation
● Discretization and Binarization
● Attribute Transformation
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Aggregation
● Combining two or more attributes (or objects) into
a single attribute (or object)
● Purpose
– Data reduction
u Reduce the number of attributes or objects
– Change of scale
u Cities aggregated into regions, states, countries, etc
– More �stable� data
u Aggregated data tends to have less variability
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Aggregation-Why?
● Less memory & less processing times
– Aggregation allows to use very expensive Algorithms
● High level view of the data
– Store example
● Behavior of groups of objects often more stable
than individual objects.
– A disadvantage of this is losing information or
patterns,
– e.g. if you aggregate days into months, you might
miss the sales peak in Valentine’s Day.
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Aggregation
Standard Deviation of Average
Monthly Precipitation
Standard Deviation of Average
Yearly Precipitation
Variation of Precipitation in Australia
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Sampling
● Sampling is the main technique employed for data selection.
– It is often used for both the preliminary investigation of the data
and the final data analysis.
● Statisticians sample because obtaining the entire set of data
of interest is too expensive or time consuming.
● Sampling is used in data mining because processing the
entire set of data of interest is too expensive or time
consuming.
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Sampling …
● The key principle for effective sampling is the
following:
– using a sample will work almost as well as using the
entire data sets, if the sample is representative
– A sample is representative if it has approximately the
same property (of interest) as the original set of data
– If mean is of interest then the mean of the sample,
should be similar to mean of the full data.
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Types of Sampling
● Simple Random Sampling
– There is an equal probability of selecting any particular item
● Sampling without replacement
– As each item is selected, it is removed from the population
● Sampling with replacement
– Objects are not removed from the population as they are
selected for the sample.
u In sampling with replacement, the same object can be picked up
more than once (easier to analyze, probability is constant)
● Stratified sampling
– Split the data into several partitions; then draw random samples
from each partition (handles representation of less freq. objects)
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Sample Size
8000 points 2000 Points 500 Points
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Sample Size
● What sample size is necessary to get at least one
object from each of 10 groups.
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Curse of Dimensionality
● When dimensionality
increases, data becomes
increasingly sparse in the
space that it occupies
● Definitions of density and
distance between points,
which is critical for
clustering and outlier
detection, become less
meaningful
• Randomly generate 500 points
• Compute difference between max and min
distance between any pair of points
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Dimensionality Reduction
● Purpose:
– Avoid curse of dimensionality
– Reduce amount of time and memory required by data
mining algorithms
– Allow data to be more easily visualized
– May help to eliminate irrelevant features or reduce
noise
● Techniques
– Principle Component Analysis
– Singular Value Decomposition
– Others: supervised and non-linear techniques
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Dimensionality Reduction: PCA
● Goal is to find a projection that captures the
largest amount of variation in data
x2
x1
e
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Dimensionality Reduction: PCA
● Find the eigenvectors of the covariance matrix
● The eigenvectors define the new space
● Tends to identify strongest patterns in data.
x2
x1
e
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Dimensions = 10Dimensions = 40Dimensions = 80Dimensions = 120Dimensions = 160Dimensions = 206
Dimensionality Reduction: PCA
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Face detection and recognition
Detection Recognition “Sally”
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Feature Subset Selection
● Another way to reduce dimensionality of data
● Redundant features
– duplicate much or all of the information contained in
one or more other attributes
– Example: purchase price of a product and the amount
of sales tax paid
● Irrelevant features
– contain no information that is useful for the data
mining task at hand
– Example: students’ ID is often irrelevant to the task of
predicting students’ GPA
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Feature Subset Selection
● Techniques:
– Brute-force approch:
uTry all possible feature subsets as input to data mining algorithm
– Embedded approaches:
u Feature selection occurs naturally as part of the data mining
algorithm
– Filter approaches:
u Features are selected before data mining algorithm is run
– Wrapper approaches:
u Use the data mining algorithm as a black box to find best subset
of attributes
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Feature Subset Selection
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Feature Creation
● Create new attributes that can capture the
important information in a data set much more
efficiently than the original attributes
● Three general methodologies:
– Feature Extraction
u domain-specific
– Mapping Data to New Space
– Feature Construction
u combining features (pixels à edges for face recognition)
u e.g. using density instead of mass, volume in identifying
artifacts such as gold, bronze, clay, etc…
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Similarity and Dissimilarity
● Similarity
– Numerical measure of how alike two data objects are.
– Is higher when objects are more alike.
– Often falls in the range [0,1]
● Dissimilarity
– Numerical measure of how different are two data
objects
– Lower when objects are more alike
– Minimum dissimilarity is often 0
– Upper limit varies
● Proximity refers to a similarity or dissimilarity
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Similarity/Dissimilarity for Simple Attributes
p and q are the attribute values for two data objects.
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Similarity/Dissimilarity for Simple Attributes
● An example: quality of a product (e.g. candy)
{poor, fair, OK, good, wonderful}
● P1->Wonderful, P->2 good, P3->OK
● P1 is closer to P2 than it is to P3
● Map ordinal attributes into integers:
{poor=0, fair=1, OK=2, good=3, wonderful=4}
● Estimate the distance values for each pair.
● Normalize if you want [1,1] interval
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Euclidean
Distance
● Euclidean Distance
Where n is the number of dimensions (attributes) and pk and q
k
are, respectively, the kth attributes (components) or data
objects p and q.
● Standardization is necessary, if scales differ.
å
=
-=
n
k
kk qpdist
1
2)(
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Euclidean Distance
0
1
2
3
0 1 2 3 4 5 6
p1
p2
p3 p4
point x y
p1 0 2
p2 2 0
p3 3 1
p4 5 1
Distance Matrix
p1 p2 p3 p4
p1 0 2.828 3.162 5.099
p2 2.828 0 1.414 3.162
p3 3.162 1.414 0 2
p4 5.099 3.162 2 0
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Minkowski Distance
● Minkowski Distance is a generalization of Euclidean
Distance
Where r is a parameter, n is the number of dimensions
(attributes) and pk and qk are, respectively, the kth attributes
(components) or data objects p and q.
r
n
k
r
kk qpdist
1
1
)||( å
=
-=
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Minkowski Distance: Examples
● r = 1. City block (Manhattan, taxicab, L1 norm) distance.
– A common example of this is the Hamming distance, which is just the
number of bits that are different between two binary vectors
● r = 2. Euclidean distance
● r ® ¥. �supremum� (Lmax norm, L¥ norm) distance.
– This is the maximum difference between any component of the vectors
● Do not confuse r with n, i.e., all these distances are
defined for all numbers of dimensions.
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Minkowski Distance
Distance Matrix
point x y
p1 0 2
p2 2 0
p3 3 1
p4 5 1
L1 p1 p2 p3 p4
p1 0 4 4 6
p2 4 0 2 4
p3 4 2 0 2
p4 6 4 2 0
L2 p1 p2 p3 p4
p1 0 2.828 3.162 5.099
p2 2.828 0 1.414 3.162
p3 3.162 1.414 0 2
p4 5.099 3.162 2 0
L¥ p1 p2 p3 p4
p1 0 2 3 5
p2 2 0 1 3
p3 3 1 0 2
p4 5 3 2 0
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Common Properties of a Distance
● Distances, such as the Euclidean distance,
have some well known properties.
1. d(p, q) ³ 0 for all p and q and d(p, q) = 0 only if
p = q. (Positive definiteness)
2. d(p, q) = d(q, p) for all p and q. (Symmetry)
3. d(p, r) £ d(p, q) + d(q, r) for all points p, q, and r.
(Triangle Inequality)
where d(p, q) is the distance (dissimilarity) between
points (data objects), p and q.
● A distance that satisfies these properties is a
metric
● Examples 2.14 and 2.15
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Common Properties of a Similarity
● Similarities, also have some well known
properties.
1. s(p, q) = 1 (or maximum similarity) only if p = q.
2. s(p, q) = s(q, p) for all p and q. (Symmetry)
where s(p, q) is the similarity between points (data
objects), p and q.
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
SMC versus Jaccard: Example
p = 1 0 0 0 0 0 0 0 0 0
q = 0 0 0 0 0 0 1 0 0 1
M01 = 2 (the number of attributes where p was 0 and q was 1)
M10 = 1 (the number of attributes where p was 1 and q was 0)
M00 = 7 (the number of attributes where p was 0 and q was 0)
M11 = 0 (the number of attributes where p was 1 and q was 1)
SMC = (M11 + M00)/(M01 + M10 + M11 + M00) = (0+7) / (2+1+0+7) = 0.7
J = (M11) / (M01 + M10 + M11) = 0 / (2 + 1 + 0) = 0
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Cosine Similarity
● If d1 and d2 are two document vectors, then
cos( d1, d2 ) = (d1 • d2) / ||d1|| ||d2|| ,
where • indicates vector dot product and || d || is the length of vector d.
● Example:
d1 = 3 2 0 5 0 0 0 2 0 0
d2 = 1 0 0 0 0 0 0 1 0 2
d1 • d2= 3*1 + 2*0 + 0*0 + 5*0 + 0*0 + 0*0 + 0*0 + 2*1 + 0*0 + 0*2 = 5
||d1|| = (3*3+2*2+0*0+5*5+0*0+0*0+0*0+2*2+0*0+0*0)0.5 = (42) 0.5 = 6.481
||d2|| = (1*1+0*0+0*0+0*0+0*0+0*0+0*0+1*1+0*0+2*2) 0.5 = (6) 0.5 = 2.245
cos( d1, d2 ) = .3150
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Correlation
● Correlation measures the linear relationship
between objects
● To compute correlation, we standardize data
objects, p and q, and then take their dot product
)(/))(( pstdpmeanpp kk -=¢
)(/))(( qstdqmeanqq kk -=¢
qpqpncorrelatio ¢•¢=),(
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Correlation
● Correlation measures the linear relationship
between objects
● To compute correlation, we standardize data
objects, p and q, and then take their dot product
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Visually Evaluating Correlation
Scatter plots
showing the
similarity from
–1 to 1.
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Density
● Density-based clustering require a notion of
density
● Examples:
– Euclidean density
u Euclidean density = number of points per unit volume
– Probability density
– Graph-based density
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Euclidean Density – Cell-based
● Simplest approach is to divide region into a
number of rectangular cells of equal volume and
define density as # of points the cell contains
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 ‹#›
Euclidean Density – Center-based
● Euclidean density is the number of points within a
specified radius of the point
We provide professional writing services to help you score straight A’s by submitting custom written assignments that mirror your guidelines.
Get result-oriented writing and never worry about grades anymore. We follow the highest quality standards to make sure that you get perfect assignments.
Our writers have experience in dealing with papers of every educational level. You can surely rely on the expertise of our qualified professionals.
Your deadline is our threshold for success and we take it very seriously. We make sure you receive your papers before your predefined time.
Someone from our customer support team is always here to respond to your questions. So, hit us up if you have got any ambiguity or concern.
Sit back and relax while we help you out with writing your papers. We have an ultimate policy for keeping your personal and order-related details a secret.
We assure you that your document will be thoroughly checked for plagiarism and grammatical errors as we use highly authentic and licit sources.
Still reluctant about placing an order? Our 100% Moneyback Guarantee backs you up on rare occasions where you aren’t satisfied with the writing.
You don’t have to wait for an update for hours; you can track the progress of your order any time you want. We share the status after each step.
Although you can leverage our expertise for any writing task, we have a knack for creating flawless papers for the following document types.
Although you can leverage our expertise for any writing task, we have a knack for creating flawless papers for the following document types.
From brainstorming your paper's outline to perfecting its grammar, we perform every step carefully to make your paper worthy of A grade.
Hire your preferred writer anytime. Simply specify if you want your preferred expert to write your paper and we’ll make that happen.
Get an elaborate and authentic grammar check report with your work to have the grammar goodness sealed in your document.
You can purchase this feature if you want our writers to sum up your paper in the form of a concise and well-articulated summary.
You don’t have to worry about plagiarism anymore. Get a plagiarism report to certify the uniqueness of your work.
Join us for the best experience while seeking writing assistance in your college life. A good grade is all you need to boost up your academic excellence and we are all about it.
We create perfect papers according to the guidelines.
We seamlessly edit out errors from your papers.
We thoroughly read your final draft to identify errors.
Work with ultimate peace of mind because we ensure that your academic work is our responsibility and your grades are a top concern for us!
Dedication. Quality. Commitment. Punctuality
Here is what we have achieved so far. These numbers are evidence that we go the extra mile to make your college journey successful.
We have the most intuitive and minimalistic process so that you can easily place an order. Just follow a few steps to unlock success.
We understand your guidelines first before delivering any writing service. You can discuss your writing needs and we will have them evaluated by our dedicated team.
We write your papers in a standardized way. We complete your work in such a way that it turns out to be a perfect description of your guidelines.
We promise you excellent grades and academic excellence that you always longed for. Our writers stay in touch with you via email.