Lab Report

I need a lab report written with the sources and information I provide.

BIOlab report

Don't use plagiarized sources. Get Your Custom Essay on

Lab Report

Just from $13/Page

Order Essay

Experiment 1: Descriptive Title of Lab Report

BSC 110L Section H001

September 31, 2019

TA: Jane Doe

ABSTRACT

This section is usually written last and summarizes the entire lab report. The general formula for writing the abstract is as follows:

First sentence = Summary of the introduction

Second sentence = Summary of the hypothesis and methods

Third sentence = Summary of the results and if the hypothesis was supported or not.

Fourth sentence = Summary of the discussion.

Fifth sentence = Summary of the conclusion (that is in the discussion).

Be sure to include your hypothesis, statement of purpose, materials and methods, results, and major conclusions. Total, this section should be between 100 and 200 words.

INTRODUCTION

The introduction and discussion should be the longest sections in your lab report. In this section you will spend a minimum of three paragraphs describing the science behind the experiment, state a hypothesis and explain your expectations and purpose behind doing the experiment. Remember that the introduction is where you put all of the information so that the reader will be able to understand the experiment, results and discussion. You should give enough background in this section that a person would reasonably come to the same hypothesis as to yours. There should be a lot of in-text citations in this section, which means you will be summarizing an idea from a primary source, paraphrasing the content and then giving credit through the in text citation. If you need help paraphrasing, use the guide in your lab manual on page 119 – 120.

To have an awesome introduction be sure to provide accurate background information using relevant vocabulary. From that relevant information, create a clear and well written hypothesis. Provide predictions and expectations of the experiment, and provide justification based on background your introduction provides. Discuss how the background information you provide ties into the purpose and hypothesis of the lab report. Use recent information, no older than a decade as science moves fast and some articles before 2009 may be out of date now.

As an extra note, when you include an organism in your introduction you should first mention the common name, species name, and then refer to it as the G. specific epithet name if in the same paragraph or within a sentence. The caveats to this are that you cannot start a sentence with an abbreviation (i.e. cannot start a sentence with G. species). When you mention the species in a new paragraph you need to restate the genus. I’ve included an example in grey below:

The Atlantic cownose ray, Rhinoptera bonasus, and the Brazilian cownose ray, R. brasiliensis, have overlapping morphological features that have resulted in their misidentification in the field.

Rhinoptera rays have been documented in the western Atlantic ranging from…

MATERIALS AND METHODS

This should be short and sweet, but given with enough detail that the experiment could be recreated. The first paragraph should include the materials used in the experiment, written as a sentence opposed to listing. The second paragraph should include the procedure, and should be a chronological account of the steps you took to test your hypothesis, while avoiding unnecessary details. You should write in past tense, third person and summarize the procedures from your lab manual.

Ideally, you would include all quantities of each material and the purpose of each material. A descriptive account of procedure and control groups, and the types of data that was collected.

RESULTS AND ANALYSIS

NO RAW DATA!

Raw data is a term that refers to numbers that are not given context. For example, raw data would be several measures on a ruler (2”, 4”, 5”, 6”, 3”, 1”) over the course of 60 seconds. Because the reader would not easily be able to see the pattern, these measurements would constitute raw data. Instead, you should transform your raw data into a graph or chart.

Figure 1: The movement of a startled cockroach was described as if first advanced towards the disturbance (and away from its home), then retreated back towards its home.

Describe the trends in the data you found, linking to figures at the end of each sentence (when appropriate). Think critically about what way best illustrates the trends found in your data visually. Bar graph? Line graph? Pie chart? Be sure to give units of measurement, and any calculations you preformed.

DISCUSSION

Restate your hypothesis and state if it was supported or if it was not supported. Explain how you came to that conclusion by interpreting your results. Critically examine the results you found without mentioning limitations, biases, etc. Why do you think your hypothesis was supported or not supported? Explain the physiological reason or mechanism behind your findings. Use specific examples from the data to expand on this.

Explain the data with scientific concepts and vocabulary, and reflect on the errors or limitations from the experiment and how you would improve them. Discuss a question that still needs to be investigated for the experiment and apply the concepts you discovered to real life.

Example to choose a title:

If I wrote:

Rhinoptera brasiliensis were historically documented as a resident species, endemic to 180 kilometers (km) along the southern coast of Brazil (Schwartz 1990). The resident status of this ray was brought into question in 2007, when three individuals of the species were found in Mississippi Sound, approximately 7,500 km outside their previous range (Jones et al. 2017). Rhinoptera sampled in the Gulf of Mexico (n = 474) consisted of approximately 20% R. brasiliensis, supporting the suspected extension of their documented range, and altering their status from resident, to migrant.

Key words: Rhinoptera brasiliensis, Gulf of Mexico, Resident, Migrant, Range extension, Mississippi Sound, Genetics (although it was not mentioned in the few sentences I wrote, it is my method, so I always include it).

Possible titles:

1. Re-evaluating the documented range of the Brazilian cownose ray, Rhinoptera brasiliensis, in the Gulf of Mexico with genetic tools

2. Started from the bottom, now Brazilian cownose rays are here: investigating the range expansion of a benthic ray, Rhinoptera brasiliensis, into the Mississippi Sound

I hope that helps your come up with an idea for a title!

You will format your literature cited this way, for journal articles:

Smith, T., Jones, K. and Taylor, R. 2007. Article title. Journal. Volume: Page – Page.

This way for books:

First Authors Last Name, A., and Second Authors, A. Year published. Book title. Publisher name, Publishing city, Publishing state. Page – Page.

LITERATURE CITED

Catlin, P. 2009. Extinction and the importance of history and dependence in conservation. Biodiversity. 2: 2 – 13.

Mangol, A., Verra, T., and Lotus, F. 2010. Biological history and demography of ferns. Fernwood Conservation. 12: 1 – 19.

Weaver, H. 2018. The importance of conservation. Conservation and Society. 1: 10 – 15.

Cockroach Advance and Retreat

Movement over time 10 20 30 40 50 60 2 4 5 6 3 1

Seconds

Distance Moved From Home (Inches)

NAME_____________________________________ DATE_____________________________

TA:__________________________ Student ID____________________

CHECK the following before you submit your assignment to your TA:

The lab report is submitted via Turnitin on Canvas, the TA will not accept a hard copy or late work (no exceptions).

The ENTIRE rubric is printed with your name and student ID

The Turnitin.com submission confirmation sheet is stapled to the lab report.

All required components, as listed on the rubric, are included in the lab report. Zero points will be awarded in the category

of a missing component.

Exceeds

Standard

Meets
Standard

Nearly Meets

Standard

Below

Standard

Little Progress

Toward Standard

Total

Abstract

** Possible 10 points

· Stand-alone accurate synopsis of lab report

· Includes: hypothesis, purpose statement, materials/methods, results and major conclusions

· Paragraph form

· 100-200 words

Does not include 1 of the following:

· Paragraph form
· 100-200 words

· Missing hypothesis, purpose statement, materials/methods, results and/or major conclusions

· Stand-alone accurate synopsis of lab report

Does not include 2 of the following:

· Paragraph form
· 100-200 words
· Missing hypothesis, purpose statement, materials/methods, results and/or major conclusions
· Stand-alone accurate synopsis of lab report

Does not include 3 of the following:

· Paragraph form
· 100-200 words
· Missing hypothesis, purpose statement, materials/methods, results and/or major conclusions
· Stand-alone accurate synopsis of lab report

Does not include 4 or more of the following:

· Paragraph form
· 100-200 words
· Stand-alone accurate synopsis of lab report

· hypothesis, purpose statement, materials/methods, results and/or major conclusions

· Stand-alone accurate synopsis of lab report

Introduction
(Does the background material relate to the topic of the investigation?)

**Possible 25 Points

· Provided accurate and sufficient background information from primary sources to support your hypothesis; relates to the topic being investigated; relevant and up to date

· A clear hypothesis and an informed prediction

· Justified the prediction with prior knowledge

· A clear purpose statement

· Explained the purpose statement

· Recent background information (before 2007)

· Connected the purpose to the background information from primary sources

· Discussion of content as it relates to the topic (how the background material relates to the topic of the investigation)

Does not include 1 of the following:
· Provided accurate and sufficient background information from primary sources to support your hypothesis; relates to the topic being investigated; relevant and up to date

· A clear hypothesis and an informed prediction

· Justified the prediction with prior knowledge
· A clear purpose statement
· Explained the purpose statement
· Recent background information (before 2007)
· Connected the purpose to the background information from primary sources
· Discussion of content as it relates to the topic (how the background material relates to the topic of the investigation)

Does not include 2 of the following:
· Provided accurate and sufficient background information from primary sources to support your hypothesis; relates to the topic being investigated; relevant and up to date
· A clear hypothesis and an informed prediction
· Justified the prediction with prior knowledge
· A clear purpose statement
· Explained the purpose statement
· Recent background information (before 2007)
· Connected the purpose to the background information from primary sources
· Discussion of content as it relates to the topic (how the background material relates to the topic of the investigation)

Does not include 3 of the following:

· Provided accurate and sufficient background information from primary sources to support your hypothesis; relates to the topic being investigated; relevant and up to date

· A clear hypothesis and an informed prediction
· Justified the prediction with prior knowledge
· A clear purpose statement
· Explained the purpose statement
· Recent background information (before 2007)
· Connected the purpose to the background information from primary sources
· Discussion of content as it relates to the topic (how the background material relates to the topic of the investigation)

Does not include 4 or more of the following:
· Provided accurate and sufficient background information from primary sources to support your hypothesis; relates to the topic being investigated; relevant and up to date
· A clear hypothesis and an informed prediction
· Justified the prediction with prior knowledge
· A clear purpose statement
· Explained the purpose statement
· Recent background information (before 2007)
· Connected the purpose to the background information from primary sources
· Discussion of content as it relates to the topic (how the background material relates to the topic of the investigation)

Materials / Procedure

(Could the investigation be repeated with the information provided?)
**Possible 10 points

· Paragraph, not list, that includes all quantities and purpose for each materials used

· Paragraph, not list, detailing the complete steps of the procedure in order in which they occurred

· Includes description of treatment and control groups

· Included types of data collected (

units

of measurement included when appropriate)

Does not include 1 of the following:
· Paragraph, not list, that includes all quantities and purpose for each materials used
· Paragraph, not list, detailing the complete steps of the procedure in order in which they occurred
· Includes description of treatment and control groups
· Included types of data collected (units of measurement included when appropriate)

Does not include 2 of the following:
· Paragraph, not list, that includes all quantities and purpose for each materials used
· Paragraph, not list, detailing the complete steps of the procedure in order in which they occurred
· Includes description of treatment and control groups
· Included types of data collected (units of measurement included when appropriate)

Does not include 3 of the following:
· Paragraph, not list, that includes all quantities and purpose for each materials used
· Paragraph, not list, detailing the complete steps of the procedure in order in which they occurred
· Includes description of treatment and control groups
· Included types of data collected (units of measurement included when appropriate)

Does not include 4 of the following:

· Paragraph, not list, that includes all quantities and purpose for each materials used
· Paragraph, not list, detailing the complete steps of the procedure in order in which they occurred
· Includes description of treatment and control groups
· Included types of data collected (units of measurement included when appropriate)

Results

(Data and Analysis)

** Possible 20 points

· Included detailed and precise observations for all data included

· Included any appropriate calculations

· Included graphs and/or tables with proper title/labels/captions/

units

· Summarized data completely and effectively within a detailed paragraph

Does not include 1 of the following:
· Included detailed and precise observations for all data included
· Included any appropriate calculations
· Included graphs and/or tables with proper title/labels/captions/units
· Summarized data completely and effectively within a detailed paragraph

Does not include 2 of the following:
· Included detailed and precise observations for all data included
· Included any appropriate calculations
· Included graphs and/or tables with proper title/labels/captions/
units
· Summarized data completely and effectively within a detailed paragraph

Does not include 3 of the following:
· Included detailed and precise observations for all data included
· Included any appropriate calculations
· Included graphs and/or tables with proper title/labels/captions/
units
· Summarized data completely and effectively within a detailed paragraph

Does not include 4 of or more the following:

· Included detailed and precise observations for all data included
· Included any appropriate calculations
· Included graphs and/or tables with proper title/labels/captions/
units
· Summarized data completely and effectively within a detailed paragraph

Conclusion

**Possible 30 Points

· Restated hypothesis

· Discussed the validity of the hypothesis

· Restated purpose statement

· Used scientific concepts to explain the data

· Cited specific evidence from the data or observations

· Reflected on errors or limitations (how the limitations may have affected the outcome of the lab)

· A discussion of questions that still remain or improvements and modifications that could be made to the lab

· Connected the results to the background information from primary sources

Does not include 1 of the following:
· Restated hypothesis
· Discussed the validity of the hypothesis
· Restated purpose statement
· Used scientific concepts to explain the data
· Cited specific evidence from the data or observations
· Reflected on errors or limitations (how the limitations may have affected the outcome of the lab)
· A discussion of questions that still remain or improvements and modifications that could be made to the lab
· Connected the results to the background information from primary sources

Does not include 2 of the following:
· Restated hypothesis
· Discussed the validity of the hypothesis
· Restated purpose statement
· Used scientific concepts to explain the data
· Cited specific evidence from the data or observations
· Reflected on errors or limitations (how the limitations may have affected the outcome of the lab)
· A discussion of questions that still remain or improvements and modifications that could be made to the lab
· Connected the results to the background information from primary sources

Does not include 3 of the following:
· Restated hypothesis
· Discussed the validity of the hypothesis
· Restated purpose statement
· Used scientific concepts to explain the data
· Cited specific evidence from the data or observations
· Reflected on errors or limitations (how the limitations may have affected the outcome of the lab)
· A discussion of questions that still remain or improvements and modifications that could be made to the lab
· Connected the results to the background information from primary sources

Does not include 4 or more of the following:
· Restated hypothesis
· Discussed the validity of the hypothesis
· Restated purpose statement
· Used scientific concepts to explain the data
· Cited specific evidence from the data or observations
· Reflected on errors or limitations (how the limitations may have affected the outcome of the lab)
· A discussion of questions that still remain or improvements and modifications that could be made to the lab
· Connected the results to the background information from primary sources

Grammar and Formatting

**Possible 5 points

Format

· Created a correct title page, with a title that accurately reflects the experiment

· Included all required sections with headings

· Stapled; typed in a 12-point Times New Roman, 1 inch margins, and double spaced

· Minimum 3 pages meet

Grammar

Meet all basic English standards (no errors)

· Used CBE format (correctly)

· Included in-text citations in CBE format

· Included a works cited page in CBE format

· Written the report in third person and past tense

· Made no errors in spelling, grammar, and word usage

Does not include 1 of the following:

Format
· Created a correct title page, with a title that accurately reflects the experiment
· Included all required sections with headings
· Stapled; typed in a 12-point Times New Roman, 1 inch margins, and double spaced
· Minimum 3 pages meet

Grammar
Meet all basic English standards (no errors)
· Used CBE format (correctly)
· Included in-text citations in CBE format
· Included a works cited page in CBE format
· Written the report in third person and past tense
· Made no errors in spelling, grammar, and word usage

Does not include 2 of the following:

Does not include 3 of the following:

Does not include 4 or more of the following:

Total Possible Points 100 points Points Earned _________

Point deductions

Deduction: _____

· Failure to include a work cited page will result in a zero.

Deduction: ______

· Work Cited Page: 3 primary literature sources each of which is actually cited within the lab report

· For each missing or uncited primary source, 5 points will be deducted from the entire assignment.

Deduction: ______

· Turnintin.com Confirmation sheet

· Failure to include Confirmation sheet will result in a deduction of 5 points from the entire assignment.

· Failure to turn assignment in through Turnitin by the deadline will result in a zero.

Deduction: _____

· Quotations: There should be no use of quotations for this assignment.

· For every quotation used, 5 points will be deducted from the entire assignment.

TOTAL POINTS _______ (Points Earned Minus Any Deductions)

TA COMMENTS:

RESEARCH ARTICLE

Effect of pH on Cleavage of Glycogen by
Vaginal Enzymes
Greg T. Spear1*, Mary McKenna1, Alan L. Landay1, Hadijat Makinde1, Bruce Hamaker2,
Audrey L. French3, Byung-Hoo Lee4

1 Department of Immunology/Microbiology, Rush University Medical Center, Chicago, Illinois, United States
of America, 2 Whistler Center for Carbohydrate Research, Department of Food Science, Purdue University,
West Lafayette, Indiana, United States of America, 3 CORE Center of Cook County Health and Hospitals
System, Department of Medicine, Rush University Medical Center, Chicago, Illinois, United States of
America, 4 Department of Food Science and Biotechnology, College of BioNano Technology, Gachon
University, Seongnam, Korea

* gspear@rush.edu

Abstract
Glycogen expressed by the lower genital tract epithelium is believed to support Lactobacil-
lus growth in vivo, although most genital isolates of Lactobacillus are not able to use glyco-
gen as an energy source in vitro. We recently reported that α-amylase is present in the

genital fluid of women and that it breaks down glycogen into small carbohydrates that sup-

port growth of lactobacilli. Since the pH of the lower genital tract can be very low, we deter-

mined how low pH affects glycogen processing by α-amylase. α-amylase in saliva

degraded glycogen similarly at pH 6 and 7, but activity was reduced by 52% at pH 4. The

glycogen degrading activity in nine genital samples from seven women showed a similar

profile with an average reduction of more than 50% at pH 4. However, two samples col-

lected from one woman at different times had a strikingly different pH profile with increased

glycogen degradation at pH 4, 5 and 6 compared to pH 7. This second pH profile did not cor-

relate with levels of human α-acid glucosidase or human intestinal maltase glucoamylase.

High-performance anion-exchange chromatography showed that mostly maltose was pro-

duced from glycogen by samples with the second pH profile in contrast to genital α-amylase

that yielded maltose, maltotriose and maltotetraose. These studies show that at low pH, α-

amylase activity is reduced to low but detectable levels, which we speculate helps maintain

Lactobacillus growth at a limited but sustained rate. Additionally, some women have a geni-
tal enzyme distinct from α-amylase with higher activity at low pH. Further studies are

needed to determine the identity and distribution of this second enzyme, and whether its

presence influences the makeup of genital microbiota.

Introduction
The lower genital tract microbiota of many women is dominated by bacteria of the genus Lac-
tobacillus. In those women, production of lactic acid by Lactobacillus acidifies the vaginal

PLOS ONE | DOI:10.1371/journal.pone.0132646 July 14, 2015 1 / 10

a11111

OPEN ACCESS

Citation: Spear GT, McKenna M, Landay AL,
Makinde H, Hamaker B, French AL, et al. (2015)
Effect of pH on Cleavage of Glycogen by Vaginal
Enzymes. PLoS ONE 10(7): e0132646. doi:10.1371/
journal.pone.0132646

Editor: Guangming Zhong, Univ. of Texas Health
Science Center at San Antonio, UNITED STATES

Received: March 26, 2015

Accepted: June 16, 2015

Published: July 14, 2015

Copyright: © 2015 Spear et al. This is an open
access article distributed under the terms of the
Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are
credited.

Data Availability Statement: All relevant data are
within the paper.

Funding: Funding was provided by NIH grant
AI082971.

Competing Interests: The authors have declared
that no competing interests exist.

http://crossmark.crossref.org/dialog/?doi=10.1371/journal.pone.0132646&domain=pdf

http://creativecommons.org/licenses/by/4.0/

Ryan Dupart

environment resulting in an acidic pH [1]. A vaginal fluid pH of <4.5 is often used clinically as a characteristic to determine if a woman has a “healthy” microbiota while a pH of >4.5 is char-
acteristic of bacterial vaginosis [2]. In a study that compared genital pH with microbiota identi-
fied by high throughput sequencing, Ravel et al. [3] found that in women whose lower genital
tract microbiota was dominated by Lactobacillus, the pH was typically 4–4.5 while in most of
the women whose microbiota was not dominated by Lactobacillus, the pH was >5.5. The low
pH created by Lactobacillus is thought to be the main mechanism by which colonization by this
bacterium reduces susceptibility of women to acquiring sexually transmitted infections [4–6].
It has been recognized for some time that glycogen, produced by the genital epithelium, is
an important source of carbohydrate for growth of Lactobacillus in the lower genital tract [7].
However, ostensibly paradoxically, glycogen cannot be used directly by most isolates of genital
Lactobacillus when cultured in vitro [8–10]. Recently, we reported that α-amylase is present in
the lower genital tract fluid of women and that this enzyme processes glycogen into dimers, tri-
mers and tetramers of glucose (maltose, maltotriose and maltotetraose) that can be utilized in
vitro by Lactobacillus [11]. While there are two forms of α-amylase in the body, salivary and
pancreatic, salivary α-amylase appears to be the major form found in the lower genital tract
[12].
Since recent studies indicated that α-amylase breakdown of glycogen is important for colo-
nization and growth of Lactobacillus in the lower genital tract, and since the lower genital tract
pH can range from neutral to very acidic, it is of interest to understand how changes in pH can
affect genital enzymatic processing of glycogen. Therefore, in this study, we determined the
effect of varying pH on glycogen digestion by both α-amylase in saliva and the enzymes present
in lower genital tract fluid.
Methods and Materials
Genital fluid and saliva
Cervical-vaginal lavage (CVL) samples were obtained from women who had provided written
informed consent by irrigation of the cervix with 10 mL of nonbacteriostatic sterile saline, fol-
lowed by aspiration from the posterior fornix. The study was approved by the Cook County
Health and Hospitals System Institutional Review Board. All procedures followed Department
of Health and Human Service guidelines. All women reported not douching and not engaging
in sex within the 48 hours before sample collection. Trichomonas and yeast were not detected
at the time of sample collection as determined by wet mount and potassium hydroxide.
All eight women were of good health. Seven were African American and one was Caucasian.
Ages of the subjects ranged from 34 to 61; 5 were premenopausal and 3 were postmenopausal.
Saliva was collected from a normal healthy adult donor, diluted 1:1 with saline, sterile fil-
tered, aliquoted and frozen. Written informed consent was obtained from this donor and the
study was approved by the Rush University Medical Center Institutional Review Board. All
procedures followed Department of Health and Human Service guidelines.
Assay for glycogen degradation
Stock solutions of buffered glycogen at either pH 4, 5, 6 or 7 were made by mixing 5 ml of
250 mM HEPES (Fisher Scientific, city state) or 5 ml of 100 mM lactic acid, with 20 ml of
10 mg/ml glycogen (oyster glycogen, Sigma Chemical Co), and 20 ml of phenol-red-free RPMI
1640 medium as a source of divalent cations (Lonza, Walkersville, MD). The pH of each stock
solution was then adjusted with HCl and sterile filtered.
Genital fluid, saliva (diluted 1:1000 in saline) or saline as a negative control (5 μl) were
mixed with the glycogen stock solution (45 μl) in tubes and incubated at 37°C for 120 minutes.
Genital pH and Glycogen Cleavage
PLOS ONE | DOI:10.1371/journal.pone.0132646 July 14, 2015 2 / 10

Ryan Dupart

After incubation, 10 μl was transferred to wells of a microtiter plate and the pH in the wells
adjusted to 7 by addition of 43 μl of 250 mM HEPES (pH 7) and 30 μl of phenol-red-free
RPMI-1640 medium.
Glycogen was detected by color development using a modification of a previously-described
assay [13] which consisted of addition to each well of 50 μl acetic acid (1.7 M), 50 μl potassium
iodate (0.1 N) and 50 μl of potassium iodide (0.1 N). Plates were agitated and after 15 min read
at 565 nm. The amount of glycogen in wells was calculated based on a standard curve made
from dilutions of glycogen.
Enzyme quantification. Both acid-α-glucosidase and intestinal maltase glucoamylase
were measured by ELISA. Kits were obtained from MyBiosource (San Diego, CA).
Quantification of bacteria by Polymerase Chain Reaction
Bacterium-specific quantitative PCR (qPCR) assays were performed on isolated CVL genomic
DNA [14]. Each 20 μl qPCR reaction contained Supermix (Bio-Rad Hercules, CA), primers,
probes (IDT, Coralville, IA), and 1–10 ng template DNA. Primers and probes for the bacteria
were described previously [14,15]. Known quantities of 16S rRNA plasmid targets were used as
standards [14,15].
Oligosaccharide Analysis by High-Performance Anion- Exchange Chromatography. A
high-performance anion-exchange chromatography (HPAEC) system equipped with an elec-
trochemical detector (Dionex, Sunnyvale, CA) was used to determine hydrolysis products gen-
erated from oyster glycogen incubated with vaginal fluids. The filtered (0.45 μm) samples were
separated using a CarboPac PA-1 pellicular anion-exchange column (Dionex) with gradient
elution from 100% eluent A (150 mM NaOH) to 100% eluent B (600 mM NaOAc in 150 mM
NaOH) [16]. Glucose (G1), maltose (G2), maltotriose (G3), maltotetraose (G4), and maltohep-
taose (G5) were run as linear maltooligosaccharide standard molecules.
Results
Effect of pH on glycogen degradation by salivary α-amylase
Since the pH of the genital tract can range from as low as 4 to neutral while the pH of saliva in
the mouth is close to neutral [17], we first determined how α-amylase in saliva functions over a
pH range. Saliva was collected from a normal adult donor and added to glycogen at either pH
4, 5, 6 or 7. At pH 6 and 7, salivary α-amylase caused the highest level of degradation (Fig 1).
At pH 5 and 4, degradation was reduced to 69 and 48% respectively of the degradation found
at pH 7.
Effect of pH on glycogen degradation by lower genital tract fluids
Lower genital tract fluid samples that were collected by lavage were also tested for degradation
of glycogen at pH 4, 5, 6 and 7. Eleven samples from 8 different women were tested (two
women provided samples at multiple time points). These samples were previously tested for α-
amylase by ELISA and had levels that ranged from 1.7 to 10.9 units/ml [11]. Nine samples
showed a pH sensitivity profile that was similar to α-amylase in saliva where maximal degrada-
tion of glycogen occurred at pH 7 and degradation was reduced, but not absent, at pH 4 (Fig
2). This included three samples from subject 4 (samples 4–1, 4–2 and 4–3) obtained at approxi-
mately one week intervals.
Interestingly, a sample taken from subject 9 (9–1) and a sample taken from the same
woman one week later (9–2) showed a substantially different pattern of pH sensitivity (Fig 2)
where degradation occurred at pH 7, but at lower pH, glycogen was degraded to a higher
Genital pH and Glycogen Cleavage
PLOS ONE | DOI:10.1371/journal.pone.0132646 July 14, 2015 3 / 10

Ryan Dupart

degree. Thus, these samples show two different patterns of pH sensitivity. In the type I pattern,
salivary amylase and nine of the lower genital tract fluid samples degraded less glycogen at pH
4 than at pH 7. In type II, two samples from the subject 9 resulted in higher glycogen degrada-
tion at pH 4 than at pH 7.
Five of the samples with a type I pattern and sample 9–2 that had a type II pH sensitivity
were also tested for glycogen degradation at pH 4 and pH 7 using a lactic acid-based buffer sys-
tem to compare with the HEPES-buffered runs described above. All of the samples degraded
glycogen at pH 7 in the lactic acid buffer. At pH 4, the 5 samples with type I pattern averaged
30% of the degradation observed at pH 7. This is in contrast to an average of 44% of pH 7 deg-
radation when performed in HEPES buffer. Thus, low pH in a lactic acid-based buffer also
reduced glycogen degradation. Subjecting sample 9–2 to pH 4 in lactic acid buffer increased
Fig 1. Effect of pH on glycogen degradation by salivary α-amylase. Saliva was collected from a normal donor and incubated with glycogen at pH 4–7.
The percent of degradation of glycogen at pH 7 is shown on the y axis. Average of four experiments. Degradation at pH 4 was significantly different than that
at pH 6 and 7 (p<0.05, Mann-Whitney test). doi:10.1371/journal.pone.0132646.g001 Genital pH and Glycogen Cleavage PLOS ONE | DOI:10.1371/journal.pone.0132646 July 14, 2015 4 / 10 degradation to 185% of that seen at pH 7 while in pH 4 HEPES buffer, the degradation was 157% of that seen at pH 7. Relationship of human enzymes, genital microbiota and genital pH to pH sensitivity of glycogen degradation To determine if other human enzymes reported to be present in lower genital secretions could be responsible for type II pH sensitivity, we measured both acid-α-glucosidase [11] and intesti- nal maltase glucoamylase [12] in 8 of the 9 genital samples (a sufficient amount of sample Fig 2. Effect of pH on glycogen degradation by lower genital tract fluids. Genital fluids were collected by lavage from eight donors. Two donors (subject 4 and subject 9) provided samples at multiple times (approximately one week apart). Lavage samples were incubated with glycogen at pH 4–7 and the percent of degradation of glycogen at pH 7 for each sample was calculated and is shown on the y axis. Each sample was run in two separate assays and the results averaged. doi:10.1371/journal.pone.0132646.g002 Genital pH and Glycogen Cleavage PLOS ONE | DOI:10.1371/journal.pone.0132646 July 14, 2015 5 / 10 49–1 was not available). Acid-α-glucosidase was present in several of the samples from women with type I pH sensitivity, but was very low to absent in the two samples with type II pH sensi- tivity (Fig 3). Intestinal maltase glucoamylase was present in both samples with type II pH sen- sitivity but was also present at higher levels in two of the samples with type I pH sensitivity (Fig 3). Therefore, the presence of these two enzymes was not associated with type II pH sensitivity. The microbiota in the lower genital tract and the vaginal pH of the women were also com- pared with type I and type II pH sensitivity of the enzymes. Neither genital levels of L. iners, L. crispatus, L. jensenii, Gardnerella vaginalis nor vaginal pH were consistently associated with either type I or type II pH sensitivity (Fig 4). Analysis of small sugars generated by genital enzymes To further characterize the type of enzymes associated with type I and type II pH sensitivity, high-performance anion-exchange chromatography was performed to identify the size of breakdown products generated from glycogen by the genital enzymes. Incubation of glycogen at pH 7 with a sample that exhibited the type I pH pattern (sample 11–1) resulted in small car- bohydrates corresponding to maltose (G2), maltotriose (G3) and maltotetraose (G4) but with no glucose (G1) (Fig 5A). This pattern of small carbohydrates is consistent with α-amylase breakdown of glycogen as observed in our previous study [11]. When digestion with this sam- ple was performed at pH 4, generation of small carbohydrates was substantially reduced (Fig 5B). Incubation of glycogen at pH 7 with a sample having the type II pH sensitivity (sample 9–1) resulted in mostly the G2 size and little if any G1, G3 or G4 (Fig 5a). At pH 4, this pattern was essentially unchanged except for an increase in the small amount of G1 (Fig 5b). The other sample with the type II pH sensitivity from the same woman, sample 9–2, resulted in essentially the same pattern of small carbohydrates as sample 9–1 at pH 4 and 7 (not shown). Fig 3. Carbohydrate-degrading enzymes in genital fluids. Levels of α-acid-glucosidase and intestinal maltase glucoamylase in genital fluid samples with Type I and Type II pH sensitivity were determined by ELISA. The average of triplicate ELISA wells is shown. doi:10.1371/journal.pone.0132646.g003 Genital pH and Glycogen Cleavage PLOS ONE | DOI:10.1371/journal.pone.0132646 July 14, 2015 6 / 10 Discussion Most lower genital tract isolates of Lactobacillus do not grow in media that contains glycogen as the only source of carbohydrates. However, our recent study shows that α-amylase is present in the lower genital tract, that this enzyme can process glycogen into small carbohydrates including maltose, maltotriose and maltotetraose, and that these small polymers of glucose are good sugar sources for growth of lactobacilli [11]. In the current study, we found that α-amy- lase activity is reduced, but not absent, at pH 4 and pH 5 when compared with pH 6–7. This could suggest that as Lactobacillus becomes the dominant vaginal bacterium and consequently lowers the vaginal pH, then processing of glycogen into small sugars by α-amylase is reduced. We speculate that this is a self-limiting step in the growth of genital lactobacilli which may help prevent rapid overgrowth and depletion of glycogen. In fact, in vitro cultures of some genital isolates of Lactobacillus can grow at exponential phase in medium with a pH as low as 3.9 if glucose is provided as a source of carbohydrate [18]. This suggests that a pH as low as 4.0 itself is not limiting for growth of genital lactobacilli, but our results suggest that the amount of small carbohydrates (e.g. maltose) could be limiting at pH 4.0 due to decreased processing of glycogen by α-amylase. We recently reported that genital levels of cell-free glycogen are higher in women that have a low vaginal pH [19,20]. This could suggest that increased genital levels of glycogen support Fig 4. Types of commensal bacteria in genital samples. Levels of vaginal bacteria and vaginal pH corresponding to samples with Type I and Type II pH sensitivity. Bacteria were quantified in genital samples by species-specific real time PCR. Representative results from two assays are shown. Each assay was run in triplicate. doi:10.1371/journal.pone.0132646.g004 Genital pH and Glycogen Cleavage PLOS ONE | DOI:10.1371/journal.pone.0132646 July 14, 2015 7 / 10 growth of Lactobacillus. However, the reduced α-amylase activity at low pH could contribute to increased levels of genital fluid glycogen since less breakdown of glycogen would occur. This introduces a chicken-and-egg type of conundrum; i.e., does high glycogen in the genital tract lead to the low vaginal pH through increased growth of lactobacilli or does the low vaginal pH lead to high glycogen due to decreased glycogen breakdown? Vaginal sexual intercourse has been linked to decreased colonization by Lactobacillus [21]. Also, condom use is associated with increased colonization of Lactobacillus [22]. Further, it is established that semen neutralizes the low pH of the genital tract [23]. Therefore, our current study provides a potential explanation for these observations: that the effects of sexual inter- course and condom use on genital microbiota could be related to semen neutralizing the pH of vaginal fluid which would lead to increased degradation of glycogen by α-amylase, which in turn could lead to low glycogen levels and consequently reduced Lactobacillus growth. In conclusion, these studies show that at low pH, α-amylase activity is reduced to lower but detectable levels which we speculate can continue to function more slowly in breakdown of gly- cogen into small polymers of glucose in the genital tract of women that have a genital tract microbiota dominated by Lactobacillus. However, these studies also show that some women have a genital enzyme that breaks down glycogen that appears distinct from α-amylase since it has higher activity at low pH. Further studies are needed to determine the identity and Fig 5. Size of small carbohydrates generated by glycogen degradation. HPAEC analysis of carbohydrates generated from glycogen by incubation with genital fluids (samples 9–1 or 11–1) or control (saline) at pH 7 (A) or pH 4 (B). The lighter trace on each graph represents the standards that were run including monomers (G1), dimers (G2), trimers (G3), tetramers (G4), and pentamers (G5). Runs were performed twice and representative results are shown. doi:10.1371/journal.pone.0132646.g005 Genital pH and Glycogen Cleavage PLOS ONE | DOI:10.1371/journal.pone.0132646 July 14, 2015 8 / 10 distribution of this second enzyme, and whether its presence influences the makeup of genital microbiota. Author Contributions Conceived and designed the experiments: BL GS AL BH AF. Performed the experiments: MM BL. Analyzed the data: BL BH GS MM HM. Contributed reagents/materials/analysis tools: AF. Wrote the paper: GS HM. References 1. Boskey ER, Telsch KM, Whaley KJ, Moench TR, Cone RA (1999) Acid production by vaginal flora in vitro is consistent with the rate and extent of vaginal acidification. Infect Immun 67: 5170–5175. PMID: 10496892 2. Amsel R, Totten PA, Spiegel CA, Chen KC, Eschenbach D, Holmes KK (1983) Nonspecific vaginitis. Diagnostic criteria and microbial and epidemiologic associations. Am J Med 74: 14–22. PMID: 6600371 3. Ravel J, Gajer P, Abdo Z, Schneider GM, Koenig SS, McCulle SL, et al. (2010) Vaginal microbiome of reproductive-age women. Proc Natl Acad Sci U S A 108 Suppl1: 4680–4687. 4. Hillier SL (1998) The vaginal microbial ecosystem and resistance to HIV. AIDS Res Hum Retroviruses 14 Suppl 1: S17–21. PMID: 9581879 5. Mirmonsef P, Spear GT (2014) The Barrier to HIV Transmission Provided by Genital Tract Lactobacillus Colonization. Am J Reprod Immunol 71: 531–536. doi: 10.1111/aji.12232 PMID: 24661438 6. O'Hanlon DE, Lanier BR, Moench TR, Cone RA (2010) Cervicovaginal fluid and semen block the micro- bicidal activity of hydrogen peroxide produced by vaginal lactobacilli. BMC Infect Dis 10: 120. doi: 10. 1186/1471-2334-10-120 PMID: 20482854 7. Cruickshank R, Sharman A (1934) The biology of the vagina in the human subject. II. The bacterial flora and secretion of the vagina at various age-periods and their relation to glycogen in the vagind epithe- lium. J Obstet Gynaec Brit Emp 41: 208. 8. Stewart-Tull DE (1964) Evidence That Vaginal Lactobacilli Do Not Ferment Glycogen. Am J Obstet Gynecol 88: 676–679. PMID: 14128200 9. Martin R, Soberon N, Vaneechoutte M, Florez AB, Vazquez F, Suarez JE (2008) Characterization of indigenous vaginal lactobacilli from healthy women as probiotic candidates. Int Microbiol 11: 261–266. PMID: 19204898 10. Wylie JG, Henderson A (1969) Identity and glycogen-fermenting ability of lactobacilli isolated from the vagina of pregnant women. J Med Microbiol 2: 363–366. PMID: 4996481 11. Spear GT, French AL, Gilbert D, Zariffard MR, Mirmonsef P, Sullivan TH, et al. (2014) Human alpha- amylase present in lower genital tract mucosal fluid processes glycogen to support vaginal colonization by Lactobacillus. J Infect Dis 210: 1019–1028. doi: 10.1093/infdis/jiu231 PMID: 24737800 12. Birse KM, Burgener A, Westmacott GR, McCorrister S, Novak RM, Ball TB (2013) Unbiased proteomics analysis demonstrates significant variability in mucosal immune factor expression depending on the site and method of collection. PLoS One 8: e79505. doi: 10.1371/journal.pone.0079505 PMID: 24244515 13. Morris DL (1946) Colorimetric determination of glycogen; disadvantages of the iodine method. J Biol Chem 166: 199–203. PMID: 20273688 14. Fredricks DN, Fiedler TL, Thomas KK, Mitchell CM, Marrazzo JM (2009) Changes in vaginal bacterial concentrations with intravaginal metronidazole therapy for bacterial vaginosis as assessed by quantita- tive PCR. J Clin Microbiol 47: 721–726. doi: 10.1128/JCM.01384-08 PMID: 19144794 15. Srinivasan S, Liu C, Mitchell CM, Fiedler TL, Thomas KK, Agnew KJ, et al. (2010) Temporal variability of human vaginal bacteria and relationship with bacterial vaginosis. PLoS One 5: e10197. doi: 10. 1371/journal.pone.0010197 PMID: 20419168 16. Lee CK, Le QT, Kim YH, Shim JH, Lee SJ, Park JH, et al. (2008) Enzymatic synthesis and properties of highly branched rice starch amylose and amylopectin cluster. J Agric Food Chem 56: 126–131. PMID: 18072737 17. Aframian DJ, Davidowitz T, Benoliel R (2006) The distribution of oral mucosal pH values in healthy saliva secretors. Oral Dis 12: 420–423. PMID: 16792729 Genital pH and Glycogen Cleavage PLOS ONE | DOI:10.1371/journal.pone.0132646 July 14, 2015 9 / 10 http://www.ncbi.nlm.nih.gov/pubmed/10496892 http://www.ncbi.nlm.nih.gov/pubmed/6600371 http://www.ncbi.nlm.nih.gov/pubmed/9581879 http://dx.doi.org/10.1111/aji.12232 http://www.ncbi.nlm.nih.gov/pubmed/24661438 http://dx.doi.org/10.1186/1471-2334-10-120 http://dx.doi.org/10.1186/1471-2334-10-120 http://www.ncbi.nlm.nih.gov/pubmed/20482854 http://www.ncbi.nlm.nih.gov/pubmed/14128200 http://www.ncbi.nlm.nih.gov/pubmed/19204898 http://www.ncbi.nlm.nih.gov/pubmed/4996481 http://dx.doi.org/10.1093/infdis/jiu231 http://www.ncbi.nlm.nih.gov/pubmed/24737800 http://dx.doi.org/10.1371/journal.pone.0079505 http://www.ncbi.nlm.nih.gov/pubmed/24244515 http://www.ncbi.nlm.nih.gov/pubmed/20273688 http://dx.doi.org/10.1128/JCM.01384-08 http://www.ncbi.nlm.nih.gov/pubmed/19144794 http://dx.doi.org/10.1371/journal.pone.0010197 http://dx.doi.org/10.1371/journal.pone.0010197 http://www.ncbi.nlm.nih.gov/pubmed/20419168 http://www.ncbi.nlm.nih.gov/pubmed/18072737 http://www.ncbi.nlm.nih.gov/pubmed/16792729 18. Martin HL, Richardson BA, Nyange PM, Lavreys L, Hillier SL, Chohan B, et al. (1999) Vaginal lactoba- cilli, microbial flora, and risk of human immunodeficiency virus type 1 and sexually transmitted disease acquisition. J Infect Dis 180: 1863–1868. PMID: 10558942 19. Mirmonsef P, Hotton AL, Gilbert D, Burgad D, Landay A, Weber KM, et al. (2014) Free Glycogen in Vaginal Fluids Is Associated with Lactobacillus Colonization and Low Vaginal pH. PLoS One 9: e102467. doi: 10.1371/journal.pone.0102467 PMID: 25033265 20. Mirmonsef P, Modur S, Burgad D, Gilbert D, Golub ET, French AL, et al. (2014) Exploratory comparison of vaginal glycogen and Lactobacillus levels in premenopausal and postmenopausal women. Meno- pause 22: 1–8. 21. Cherpes TL, Hillier SL, Meyn LA, Busch JL, Krohn MA (2008) A delicate balance: risk factors for acqui- sition of bacterial vaginosis include sexual activity, absence of hydrogen peroxide-producing lactoba- cilli, black race, and positive herpes simplex virus type 2 serology. Sex Transm Dis 35: 78–83. PMID: 17989585 22. Ma L, Lv Z, Su J, Wang J, Yan D, Wei J, et al. (2013) Consistent condom use increases the colonization of Lactobacillus crispatus in the vagina. PLoS One 8: e70716. doi: 10.1371/journal.pone.0070716 PMID: 23894682 23. Fox CA, Meldrum SJ, Watson BW (1973) Continuous measurement by radio-telemetry of vaginal pH during human coitus. J Reprod Fertil 33: 69–75. PMID: 4699448 Genital pH and Glycogen Cleavage PLOS ONE | DOI:10.1371/journal.pone.0132646 July 14, 2015 10 / 10 http://www.ncbi.nlm.nih.gov/pubmed/10558942 http://dx.doi.org/10.1371/journal.pone.0102467 http://www.ncbi.nlm.nih.gov/pubmed/25033265 http://www.ncbi.nlm.nih.gov/pubmed/17989585 http://dx.doi.org/10.1371/journal.pone.0070716 http://www.ncbi.nlm.nih.gov/pubmed/23894682 http://www.ncbi.nlm.nih.gov/pubmed/4699448

Effects of pH, temperature, enzyme-to-substrate ratio and reaction time
on the antigenicity of casein hydrolysates prepared by papain

Xiaoyu Liu, Yongkang Luo* and Zheng Li

Key Laboratory of Functional Dairy, College of Food Science and Nutritional Engineering,
China Agricultural University, Beijing, China

(Received 29 March 2011; final version received 28 June 2011

)

The effects of pH, temperature, enzyme-to-substrate ratio and reaction time on
the antigenicity of casein hydrolysates were investigated. Response surface
methodology (RSM) was employed to optimise the reaction conditions. Enzy-
matic hydrolysis with papain could reduce the antigenicity of a-casein and
b-casein effectively and the reduction of antigenicity could be controlled by
regulation of the reaction conditions. The model for optimal reaction conditions
of a lower antigenicity of a-casein and b-casein was established. Under the range
of conditions studied, enzyme-to-substrate ratio had the most significant effects
on the antigenicity of a-casein and b-casein. The anti-a-casein IgG binding
inhibition and anti-b-casein binding inhibition were both significantly negatively
related with the degree of hydrolysis (DH).

Keywords: cow’s milk allergy; a-casein; b-casein; hydrolysis; papain; ELISA;
antigen; enzyme

1. Introduction

Food allergy has become a major public health concern around the world. Cow’s

milk is thought to be one of the most common food allergies (Fritsche, 2003). A

number of studies has presented that cow’s milk protein allergy (CMPA) has an

incidence of 2�6% for infants or young children (Hill & Hosking, 1996, 1997;
Hosking, Heine, & Hill, 2000), causing serious consequences for the infants’ health.

Therefore, it is very necessary to reduce or eliminate the milk allergens.
All milk proteins appear to be potential allergens, even those present in only trace

amounts. However, the main allergens in cow’s milk protein seem to be casein, a-LA
and b-LG (Wal, 1998). Up to now, great attentions have been paid on how to reduce
the allergenicity of whey protein, technological approaches involve heat processing

(Bu, Luo, Zheng, & Zheng, 2009; Kleber & Hinrichs, 2007), enzymatic hydrolysis

(Wróblewska, Jedrychowski, Hajós, & Szabó, 2008; Zheng, Shen, Bu, & Luo, 2008),

fermentation (Bu, Luo, Zhang, & Chen, 2010), Maillard reaction (Bu, Lu, Zheng, &

Luo, 2009; Bu, Luo, Lu, & Zhang, 2010) and high pressure (Kleber, Maier, &

Hinrichs, 2007). Combined application of high pressure and hydrolysis is also used

(Chicón, López-Fandiño, Alonso, & Belloque, 2008). Enzymatic hydrolysis with

selected proteases is by far the most efficient process. Several investigators have

evaluated the immunogenicity and allergenicity of enzymatically hydrolysed casein.

*Corresponding author. Email: luoyongkang@263.net

Food and Agricultural Immunology

Vol. 23, No. 1, March 2012, 69�82

ISSN 0954-0105 print/ISSN 1465-3443 online

# 2012 Taylor & Francis

http://dx.doi.org/10.1080/09540105.2011.60477

http://www.tandfonline.com

http://dx.doi.org/10.1080/09540105.2011.604770

http://www.tandfonline.com

Wróblewska, Jedrychowski, Szabo, & Hajos (2005) carried out experiments that

commercial sodium caseinate isolate (SCI) was hydrolysed with Alcalase, pronase

and papain in a two-step process (Alcalase�papain, pronase�papain and pronase�
Alcalase) to determine the changes in the immunoreactivity of a-casein, b-casein and
k-casein, finding that the two-step process was an effective method in the reduction
of immunoreactivity of casein, however, allergenic epitopes were still present in all

peptide fractions. Hussein, Gelencse’r, Polga’r, & Hajo’s (2000) found that enzymatic

peptide modification with methionine enrichment seems to be an efficient method for

the reduction of the potential allergenic character and for the improvement of the

nutritive value of buffalo and cow milk caseins. Wróblewska, Jedrychowski, & Farjan

(2007) used Alcalase, pepsin and lactozyme in a multi-step hydrolysis (Alcalase

followed by pepsin and next lactozyme) to determine the allergenicity of a low

molecular fraction of whey protein and sodium caseinate hydrolysates and found it

did not decrease the allergenicity of both whey protein and sodium caseinate

hydrolysates.

However, fewer studies were reported to predictive the effects of various

hydrolysis parameters on the antigenicity of casein hydrolysates. Therefore, the aim

of this study was to evaluate the effects of pH, temperature, enzyme-to-substrate

ratio and reaction time on the antigenicity of casein hydrolysates prepared by papain,

optimising the reaction conditions using the response surface methodology (RSM).

2. Materials and methods

2.1 Materials

The antigen proteins used for sensitisation studies and enzyme-linked immunosor-

bent assay (ELISA) were a-casein (C-6780; purity �90%) and b-casein (C-6905;
purity �95%) purchased from Sigma Chemical Company (St. Louis, MO, USA).

Commercial casein obtained from Beijing Bio-technology Company (Beijing, China)

was used as hydrolysis reaction substrate. Papain used for the hydrolysis of casein

was purchased from FangShan Enzyme Preparation Factory (Beijing, China).

2.2 The preparation of rabbit antiserum

Rabbits for the sensitisation studies were 4�5 months old at the start of the study and
weight was about 2.0 kg. Rabbits were sensitised with bovine a-casein (Sigma, C-
6780) or b-casein (Sigma, C-6905) as shown in Table 1. Seven days after the fourth
sensitisation, blood samples were obtained from the rabbit hearts. Blood samples

were incubated for 1 h at room temperature and left overnight at 48C, then
centrifuged for 10 min at 3000 �g to obtain sera. The sera were stored at �808C until
the following analyses on the antigenicity of a-casein and b-casein by indirect
competitive ELISA.

2.3 Proteolytic activity of protease

Procedures refer to folin phenol reagent method (Lowry, Rosebrough, Farr, &

Randall, 1951).

70 X. Liu et al.

The proteolytic activity of protease was determined by folin phenol reagent

method. The protease activity of papain used in the experiment is about 98253 units g
�1

protein.

2.4 Casein hydrolysis

Coded and uncoded settings of the independent variables for casein hydrolysis
according to central composite rotatable design are presented in Table 2.

Casein was hydrolysed with papain under the conditions which were shown in

Table 3. Prior to hydrolysis, casein was dissolved in 0.067 mol/L phosphate buffer,

stirring for 15 min at the pre-treatment temperature of 508C. During hydrolysis, pH
was maintained by the addition of 1 M NaOH and 1 M HCl. The hydrolysis process

was terminated by heating the solution at 1008C for 10 min and then cooling
immediately. The DH was determined according to the trinitrobenzene sulfonic acid

(TNBS) method (Nissen, 1979).

2.5 Estimation of antigenicity of casein hydrolysates by indirect competitive enzyme-
linked immunosorbent assay (ELISA)

Specific procedures of indirect competitive ELISA refer to the method used earlier

(Zheng et al., 2008).

The residual antigenicity of casein hydrolysates was estimated by indirect

competitive ELISA. Microtitre plates with 96 wells (flat-bottomed; Costar,
Corning Inc., Corning, NY, USA) were coated with a-casein (or b-casein) which

Table 1. Immunisation procedure of New Zealand rabbits.

Sequence Intervals(days) Antigen sensitisation

Dose (mg protein/

kg weight) Treatment

First 0 Antigen/Freud complete

adjuvant

0.5 Crural

intramuscular

Second 14 Antigen/Freud

incomplete adjuvant

0.5 Dorsal

subcutaneous

Third 10 Antigen 1.0 Otic plexus

Fourth 10 Antigen 1.0 Otic plexus

Table 2. Coded and uncoded settings of the independent variables for casein hydrolysis

according to central composite rotatable design.

Independent variables

Coded level pH Temperature(8C) E/S(%) Reaction time(min)

2 6.80 60.0 3.0 1

1 6.40 55.0 2.5 11

0 6.00 50.0 2.0 90

�1 5.60 45.0 1.5 65
�2 5.20 40.0 1.0 40

Food and Agricultural Immunology 71

was diluted in 50 mM carbonate buffer (pH 9.6) at 4 mg mL�1 (at 2 mg mL�1 for
b-casein) and incubated overnight at 48C. In test tubes, 1 mg/mL solutions of
various casein hydrolysates were incubated overnight at 48C with an equivalent
volume of rabbit anti-a-casein or anti-b-casein antiserum diluted in 10 mM
phosphate-buffered saline (PBS, pH 7.4) containing 1% BSA and 0.1% Tween

(PBS�BSA�Tween 20) (1:240,000 for anti-a-casein antiserum and 1:120,000 for
anti-b-casein antiserum). The plates were washed four times the next day with

mM PBS containing 0.05% Tween 20 (PBS-T). After washing the plates, all wells

were filled with 100 mL per well of PBS�BSA�Tween 20 in order to block residual
free binding sites, and incubated for 1 h at 378C. The plates were washed and then
100 mL per well of reactive mixtures of casein hydrolysates and polyclonal rabbit
antibodies (IgG) were added and incubated for 1 h at 378C. Meanwhile, the
addition of 100 mL of individual anti-a-casein or anti-b-casein serum was taken
for the noncompetitive model. After washing the plates, the wells were filled with

100 mLper well of horseradish peroxidase (HRP) conjugated goat anti-rabbit IgG
(diluted 1:10,000) in PBS�BSA�Tween 20. After incubation for 1 h at 378C, the
plates were washed again and then 100 mL per well of 3,3’, 5,5’-tetramethylen-
benzidine (TMB, Amresco) substrate solutions were immediately added. The

plates were incubated at 378C for 10 min. Finally, 50 mL per well of 2 mol/L
H2SO4 were added to stop the reaction. Absorptions were read spectrophotome-

trically at dual wavelengths of 450 nm and 630 nm by Multiskan MK3 ELISA

plate reader (Thermo Labsystems, Franklin, MA, USA).

The residual antigenicity of casein hydrolysates was calculated as follows:

Inhibition rate ¼ðB0 � BÞ=B0 � 100% (1)

where B is the absorbance measured in the presence of casein hydrolysate and B0
is the absorbance measured in the absence of casein hydrolysate. Low inhibition

rates indicate low residual antigenicity of casein hydrolysate for a-casein and
b-casein.

2.6 Experimental design

In the experimental design, pH (X1), temperature (X2), enzyme-to-substrate ratio

(X3) and reaction time (X4) were chosen as independent variables. The two

dependent Y (Y1 and Y2) variables were to evaluate the residual antigenicity of

casein hydrolysates. Y1 reflects the residual antigenicity of a-casein of casein
hydrolysates and Y2 reflects the residual antigenicity of b-casein of casein
hydrolysates. Central composite rotatable design (CCRD) was used to optimise

independent variables, which contained five levels (Table 2) for each independent

variable, coded as �2, �1, 0, �1 and �2. Table 2 shows the correspondence
among coded values and actual values of independent variables. Table 3 illustrates

the complete central composite design, which consisted of 2
4

experiments for a

full factorial design plus 2 �4 star experiments and 12 centre experiments,
resulting in 36 experiments.

72 X. Liu et al.

Table 3. Full factorial central composite design matrix for anti-a-casein and anti-b-casein IgG binding inhibition.

Independent variables
a

Dependent variables

Assay pH T(8C) E:S(%) t(min)

Y1: Anti-a-casein
IgG binding inhibition

(%)

Y2: Anti-b-casein
IgG binding inhibition

(%) DH(%)

1 5.6(�1) 45(�1) 1.5(�1) 65(�1) 15.69 30.48 9.34
2 5.6(�1) 45(�1) 1.5(�1) 115(1) 14.14 27.23 11.58
3 5.6(�1) 45(�1) 2.5(1) 65(�1) 10.60 21.38 12.07
4 5.6(�1) 45(�1) 2.5(1) 115(1) 9.41 19.27 16.31
5 5.6(�1) 55(1) 1.5(�1) 65(�1) 13.76 26.96 13.73
6 5.6(�1) 55(1) 1.5(�1) 115(1) 12.86 25.34 9.98
7 5.6(�1) 55(1) 2.5(1) 65(�1) 9.75 19.33 15.60
8 5.6(�1) 55(1) 2.5(1) 115(1) 11.89 17.77 13.84
9 6.4(1) 45(�1) 1.5(�1) 65(�1) 19.84 38.71 8.71
10 6.4(1) 45(�1) 1.5(�1) 115(1) 15.86 31.14 10.28
11 6.4(1) 45(�1) 2.5(1) 65(�1) 12.24 24.39 11.51
12 6.4(1) 45(�1) 2.5(1) 115(1) 11.33 20.67 11.57
13 6.4(1) 55(1) 1.5(�1) 65(�1) 18.44 37.07 9.01
14 6.4(1) 55(1) 1.5(�1) 115(1) 17.11 33.11 7.68
15 6.4(1) 55(1) 2.5(1) 65(�1) 14.05 27.94 8.37
16 6.4(1) 55(1) 2.5(1) 115(1) 15.15 29.74 8.71

17 5.2(�2) 50(0) 2(0) 90(0) 13.02 25.64 9.08
18 6.8(2) 50(0) 2(0) 90(0) 18.76 36.99 7.63

19 6(0) 40(�2) 2(0) 90(0) 15.90 32.12 8.92
20 6(0) 60(2) 2(0) 90(0) 14.02 27.75 11.20

21 6(0) 50(0) 1(�2) 90(0) 23.53 39.17 9.17
22 6(0) 50(0) 3(2) 90(0) 12.52 25.04 11.01

23 6(0) 50(0) 2(0) 40(�2) 16.96 34.55 9.59
24 6(0) 50(0) 2(0) 140(2) 14.02 27.78 14.57

25 6(0) 50(0) 2(0) 90(0) 9.64 23.57 11.41

F
o

o
d

a
n

d
A

g
ric

u
ltu

ra
l

Im
m

u
n

o
lo

g
y

7
3

Table 3 (Continued )

Independent variables
a
Dependent variables
Assay pH T(8C) E:S(%) t(min)
Y1: Anti-a-casein
IgG binding inhibition
(%)
Y2: Anti-b-casein
IgG binding inhibition
(%) DH(%)

26 6(0) 50(0) 2(0) 90(0) 10.67 27.26 9.66

27 6(0) 50(0) 2(0) 90(0) 9.54 24.82 9.93

28 6(0) 50(0) 2(0) 90(0) 11.53 23.48 10.01

29 6(0) 50(0) 2(0) 90(0) 8.68 23.52 9.96

30 6(0) 50(0) 2(0) 90(0) 9.30 22.54 10.44

31 6(0) 50(0) 2(0) 90(0) 10.63 23.41 10.61

32 6(0) 50(0) 2(0) 90(0) 9.64 23.40 11.72

33 6(0) 50(0) 2(0) 90(0) 9.50 22.12 9.74

34 6(0) 50(0) 2(0) 90(0) 9.20 23.05 10.23

35 6(0) 50(0) 2(0) 90(0) 10.59 22.56 9.63

36 6(0) 50(0) 2(0) 90(0) 9.67 23.41 9.82

a
Values in parentheses are the coded levels of independent variables

7
4

X
.

L
iu

e
t

a
l.

2.7 Statistical analysis

SAS 8.2 (SAS Institute Inc., Cary, NC, USA) was applied to analyse the

experimental data. Response surface analysis took into account the main, the

quadratic and the interaction effects, according to the following equation:

Y ¼ b0 þ

i¼1
bi xi þ

i¼1
bii x

2
i þ

iBj¼2
bij xi xj (2)

where b0 is constants of the model. bi, bii and bij are regression coefficients,
respectively, for linear terms, quadratic terms and interaction terms of the model. xi
is the independent variable in the coded value. Student’s-t test was employed to assess

the significance of the b-coefficients for each dependent variable. The level of

significance was defined at PB0.05. The ANOVA is applied to evaluate the

significance and the fitness of the model, as well as the effects of individual terms

and their interactions on the responses. The three-dimensional response surface plots

were drawn using the fit quadratic polynomial equations by SAS, holding two of the

independent variables at a constant value and varying the other two variables within
the experimental range.

3. Results and discussion

3.1 Assessment on models of antigenicity of casein hydrolysates for four independent
variables

Table 3 illustrates the experimental design and results. The results for the regression

analysis are shown in Table 4. The significance and the fitness of the model were

assessed by ANOVA, in addition, the effects of individual terms and their

interactions on the responses were evaluated by ANOVA. Table 4 (‘full model’)

revealed that several terms were not significant (P�0.05). The nonsignificant terms

were eliminated to fit the full second-order model. For a-casein, the linear effects of
temperature and reaction time are not significant. However, the quadratic effects of
temperature and reaction time are significant. So the linear terms should be retained

in the model. In addition, for b-casein, the linear effect of temperature is not
significant, but the interaction effects between temperature and pH is significant. So

the linear terms of temperature should be retained in the model. This procedure

resulted in the second-order model for a-casein with eight regression terms and that
for b-casein with eight regression terms, respectively (Table 4,‘fitted model’). Table 4
showed that P-values of the ‘fitted model’ for a-casein and for b-casein were 0.0001,
respectively. The adjusted R

2
of the ‘fitted model’ for a-casein is 0.861 and that for

casein is 0.816. The small P-values and high adjusted

R
2

values demonstrate that the

model could give a good description of the relationship between responses and

independent

variables.

3.2 Inhibition of anti-a-casein IgG binding to a-casein by casein hydrolysates

The effects of four independent variables on the anti-a-casein IgG binding
inhibition could be observed by regression coefficients (Table 4) and response

surfaces (Figure 1). It is presented that both linear and quadratic effects of pH on

Food and Agricultural Immunology 75

the anti-a-casein IgG binding inhibition were highly significant (PB0.01). The
linear effect of temperature was not significant (P�0.05), however, the quadratic

effects of temperature were highly significant (PB0.01). For enzyme-to-substrate

ratio, both linear and quadratic effects were highly significant (PB0.01). The

linear effect of reaction time was not significant (P�0.05), however, the quadratic

effects of reaction time were highly significant (PB0.01). The interactive effects

among independent variables did not appear to be significant (P �0.05). Enzyme-

to-substrate ratio was with the highest absolute regression coefficient, indicating

that enzyme-to-substrate ratio was the most significant among four independent

variables.

Figure 1a presents the effects of pH (X1) and temperature (X2), where the

enzyme-to-substrate ratio and reaction time are set on constant values of 2% (w/w)

and 90 min, respectively. From Figure 1a, the anti-a-casein IgG binding inhibition
decreases with the increase of pH up to 5.5�6.0, then the anti-a-casein IgG binding
inhibition increases again. It indicates that when the pH is 5.5�6.0, the minimal anti-
a-casein IgG binding inhibition exists. Lieske & Konrad (1996) hydrolysed a-LA and
b-LG by papain and found enzymic availability was best for a-LA when pH is 3.5

Table 4. Regression coefficients for the regression model for prediction of anti-a-casein and
anti-b-casein IgG binding inhibition.

Full model Fitted model

Anti-a-casein
IgG binding

inhibition (%)

Anti-b-casein
IgG binding

inhibition (%)
Anti-a-casein
IgG binding
inhibition (%)
Anti-b-casein
IgG binding
inhibition (%)
b-

coefficient P

b-
coefficient P
b-
coefficient P
b-
coefficient P

Intercept 9.883 23.595 9.883 24.183

Linear

pH 1.558 0.0001 3.238 0.0001 1.558 0.0001 3.238 0.0001

Temperature 0.005 0.984 �0.198 0.716 0.006 0.985 �0.198 0.7

(E:S) �2.304 0.0001 �4.075 0.0001 �2.304 0.0001 �4.075 0.0001
Time �0.520 0.080 �1.480 0.012 �0.521 0.103 �1.480 0.013

Quadratic

pH
2

1.134 0.0001 1.226 0.015 1.134 0.0002 1.226 0.017

Temperature
2

0.901 0.001 0.881 0.072 0.901 0.002

(E:S)
2

1.668 0.0001 1.424 0.006 1.668 0.0001 1.424 0.006

Time
2

1.034 0.0004 1.189 0.018 1.034 0.0006 1.189 0.020

Interactions

pH �temperature 0.441 0.216 1.369 0.0496 1.369 0.055
pH �(E:S) �0.230 0.514 �0.314 0.637
pH �Time �0.226 0.520 �0.307 0.6

Temperature �(E:S) 0.664 0.069 0.884 0.193
Temperature �Time 0.540 0.134 0.707 0.294
(E:S) �Time 0.556 0.123 0.676 0.316

Other statistics

R
2

0.909 0.867 0.861 0.816

F 15.05 0.0001 9.789 0.0001 20.921 0.0001 14.979 0.0001

76 X. Liu et al.

and enzymic availability was best for b-LG when pH �7.5. This suggests that papain
may have different effects on different substrates; and for different purposes,

favourite conditions are different even using the same enzyme. The anti-a-casein
IgG binding inhibition decreases with the increase of temperature up to 48�548C,
then the anti-a-casein IgG binding inhibition increases again, which suggests that
when the temperature is 48�548C, the minimal anti-a-casein IgG binding inhibition
exists. Temperature that exceeds 558C was not effective for the reduction of
antigenicity of a-casein. However, Zheng (2009) found that temperature had no
effect on the antigenicity of b-LG but had a negative effect on the anti-a-LA IgG
binding inhibition when hydrolysing whey protein by papain. This may be that

papain has different effects on

different substrates.

The effect of pH (X1) and enzyme-to-substrate ratio (X3) is shown in the

response surface plot (Figure 1b) where the temperature and reaction time are set

on constant values of 508C and 90 min, respectively. From Figure 1b, the
inhibition decreases initially with the increase of enzyme-to-substrate ratio and

then the inhibition increases again. The minimal inhibition exists when enzyme-

to-substrate ratio is about 2.5%. It may be that with the enzyme-to-substrate ratio

increasing to 2.5%, some allergenic epitopes were destroyed, resulting in the

reduction of the allergenicity. But if the enzyme-to-substrate ratio was too high

exceeding 2.5%, the hydrolysis may be too active, some allergenic epitopes that

hidden inside may expose outside, causing the increase of the allergenicity again.

(a)

(b) (c)

(d)

(e) (f)

Figure 1. Response surfaces of the anti-a-casein IgG binding inhibition (Y1) using the
b-coefficients from the fitted model (Table 4). (a) The effect of pH (X1) and temperature (X2) on

the inhibition at E/S � 2% (w/w), reaction time 90min; (b) the effect of pH (X1) and E:S (X3) on
the inhibition at a temperature of 508C, reaction time 90min; (c) the effect of pH (X1) and
reaction time (X4) on the inhibition at temperature of 508C, E/S � 2% (w/w); (d) the effect of
temperature (X2) and E:S (X3) on the inhibition at a pH � 6, reaction time 90min; (e) the effect
of temperature (X2) and reaction time (X4)on the inhibition at a pH � 6, E/S � 2% (w/w);
(f) the effect of E:S (X3) and reaction time (X4) on the inhibition at pH � 6, temperature of 508C.

Food and Agricultural Immunology 77

It is illustrated in Figure 1c the effect of pH (X1) and reaction time (X4),

where the temperature and enzyme-to-substrate ratio are set on constant values of

508C and 2%, respectively. It shows that when reaction time is 80�100 min and
pH is 5.5�6.0, the minimal inhibition exists. If the hydrolysis last for a longer
time, some hidden allergenic epitopes may be outside, causing the allergenicity

increasing again. On the other hand, that prolonging the reaction time may cause

some bitter peptides occur, it is not good for taste. It is better to control the

reaction time around 80�100 min.
Figure 1d, Figure 1e, Figure 1f show, respectively, the effect of temperature (X2)

and E:S (X3), temperature (X2) and reaction time (X4), E:S (X3) and reaction time

(X4) on the anti-a-casein IgG binding inhibition. It can be comprehensively
concluded from the three figures that the minimal inhibition of anti-a-casein IgG
binding to a-casein exists when temperature is 48�548C, enzyme-to-substrate ratio
(E:S) is 2.5% and reaction time is 80�100 min.

The effects of the four independent variables (pH, temperature, enzyme-to-

substrate ratio and reaction time) are different on the anti-a-casein IgG binding
inhibition. Finally, the optimum values of the four independent variables to reach

minimum levels of inhibition for a-casein were as follows: pH � 5.60, T �508C, E/
S � 2.5% (w/w), reaction time � 90 min. Under the above hydrolysis conditions,
the inhibition for a-casein was 9.05% and that for b-casein was 19.25%.

3.3 Inhibition of anti-b-casein IgG binding to b-casein by casein hydrolysates

As we can see in Table 4 and Figure 2, the linear effects of pH on the anti-b-casein
IgG binding inhibition are highly significant (PB0.01), the quadratic effects of pH

were significant (PB0.05). Neither the linear effect nor the quadratic effects of
temperature is significant (P�0.05). For enzyme-to-substrate ratio, both linear and

quadratic effects are highly significant (PB0.01). And both linear and quadratic

effects of reaction time are significant (PB0.05). The interactive effects between pH

and temperature appear to be significant (PB0.05). The effect of enzyme-to-

substrate ratio is most significant among four independent variables for inhibition of

anti-b-casein IgG binding to b-casein.
The effect of pH (X1) and temperature (X2) on anti-b-casein IgG binding

inhibition (Y2) is presented in the response surface plot (Figure 2a), where the
enzyme-to-substrate ratio and reaction time are set on constant values of 2% (w/w)

and 90 min, respectively. From Figure 2a, the anti-b-casein IgG binding inhibition
decreases with the increase of pH, indicating that pH has negative effects on anti-b-
casein IgG binding inhibition. Zheng (2009) studied the antigenicity of WPC[AQ2]

hydrolysates prepared by papain, the results suggested when pH is around 5.5, the

antigenicity of a-LA is minimal. So it may be that papain could perform well in acid
environment. Temperature had negative effects on the anti-b-casein IgG binding
inhibition. With the temperature increases, the anti-b-casein IgG binding inhibition
decreases.

Figure 2b shows the effect of pH (X1) and enzyme-to-substrate ratio (X3) on the

anti-b-casein IgG binding inhibition (Y2), where the temperature and reaction time
are set on constant values of 508C and 90 min, respectively. When the

78 X. Liu et al.

enzyme-to-substrate ratio is increased from 1% to 2.4%, the inhibition decreases

rapidly and when the enzyme-to-substrate ratio exceeds 2.5%, the inhibition starts to

change slightly. Therefore, relatively high enzyme-to-substrate ratio is advantageous

to reduce the inhibition for b-casein, but ratio exceeds 2.5% has no significant impact
on the inhibition.

The effect of pH (X1) and reaction time (X4) on anti-b-casein IgG binding
inhibition (Y2) is observed in Figure 2c, where the temperature and enzyme-to-

substrate ratio are set on constant values of 508C and 2%, respectively. It shows
that the inhibition is low when reaction time is 80�100 min along with low pH.

Figure 2d, Figure 2e, Figure 2f present, respectively, the effect of temperature

(X2) and E:S (X3), temperature (X2) and reaction time (X4), E:S (X3) and reaction

time (X4) on anti-b-casein IgG binding inhibition (Y2). They suggest that
temperature has negative effect on the inhibition; and when enzyme-to-substrate

ratio reaches 2.5% and when reaction time is 80�100 min, the minimal inhibition
exists.

The optimum values of the four independent variables to yield minimum levels of

inhibition for b-casein are as follows: pH � 5.20, T �558C, E/S � 2.5% (w/w),
reaction time � 90min. Under the above hydrolysis conditions, the inhibition for a-
casein was 11.81% and that for b-casein was 18.83%.

(a)

(d)

(b) (c)
(e) (f)

Figure 2. Response surfaces of the anti-b-casein IgG binding inhibition (Y2) using the b-
coefficients from the fitted model (Table 4). (a) The effect of pH (X1) and temperature (X2) on

the inhibition at E/S � 2% (w/w), reaction time 90min; (b) the effect of pH (X1) and E:S (X3)
on the inhibition at a temperature of 508C, reaction time 90min; (c) the effect of pH (X1) and
reaction time (X4) on the inhibition at a temperature of 508C, E/S � 2% (w/w); (d) the effect of
temperature (X2) and E:S (X3) on the inhibition at a pH � 6, reaction time 90min; (e) the effect
of temperature (X2) and reaction time (X4) on the inhibition at a pH � 6, E/S � 2% (w/w); (f)
the effect of E:S (X3) and reaction time (X4) on the inhibition at pH � 6, temperature of 508C.

Food and Agricultural Immunology 79

3.4 The relation between the inhibition and the degree of hydrolysis (DH)

Figure 3 and Table 5 present the relation between the inhibition and the degree of

hydrolysis (DH). It can be observed from Figure 3 that the anti-a-casein IgG
binding inhibition and DH are negatively related. An increase in DH results in a

reduction in the inhibition for a-casein. The Ra (Table 5) between anti-a-casein IgG
binding inhibition and DH shows highly significant negative relation. For b-casein,
the anti-b-casein IgG binding inhibition is also highly significant negative with DH.
This may be that with the DH increasing, more antigen epitopes are destroyed, so

that the antigenicity reduces. However, many findings indicate that enzyme

specificity, rather than the DH seems to determine the residual antigenicity of

milk protein. Ena, van Beresteijn, Robben, & Schmidt (1995) found that the

reduction in antigenicity varied with the enzyme used, this may be due to the fact

that even if the DH is very high, the short peptides might contain the antigen

epitopes. Jost, Monti, & Pahud (1987) found that DH had no relationship with the

antigenicity. Zheng et al. (2008) concluded that the anti-a-LA IgG binding
inhibition was significantly negatively related with the DH, while the anti-b-LG
binding inhibition was not related with the DH. So we can conclude that the

hydrolysis is different for different enzymes because of the high specificities of the

enzymes, also the hydrolysis is different even using the same enzyme because of

different substrates.

4. Conclusion

Enzymatic hydrolysis with papain can reduce the antigenicity of a-casein and
b-casein effectively, however, the antigenicity of casein was not completely eliminated.

Under the range of conditions studied, enzyme-to-substrate ratio had the most

influential effect to reduce the allergenicity of casein; pH was found to influence

inhibition of a-casein and b-casein to a less extent. RSM was adequate to optimise
several independent variables of the hydrolysis process simultaneously, resulting in a

casein hydrolysate with minimum antigenicity for a-casein and b-casein. The model

R2 = 0.191

R2 = 0.3659

0
5
10

20
25

40
45

7 9 11 13 15 17
DH(%)

in
h
ib

iti
o
n
(%

)

anti- -casein inhibition

Figure 3. The relation curve between anti-a-casein (or anti-b-casein) IgG binding inhibition
and the DH. Anti-a-casein inhibition: anti-a-casein IgG binding inhibition; anti-b-casein
inhibition: anti-b-casein IgG binding inhibition; � linearity (anti-a-casein IgG binding
inhibition);—linearity (anti-b-casein IgG binding inhibition).

80 X. Liu et al.

was adequate to represent the actual relationship between responses and independent

variables. The anti-a-casein IgG binding inhibition and the anti-b-casein IgG
binding inhibition were both highly significant negative with DH.

Acknowledgements

This work was supported financially by the National Natural Science Foundation of China
(award numbers 30471224 and 30871817) and National Science and Technology Ministry of
China (award numbers 2006BAD27B04 and 2006BAD04A06).

References

Bu, G.H., Lu, J., Zheng, Z., & Luo, Y.K. (2009). Influence of Maillard reaction conditions on
the antigenicity of bovine a lactalbumin using response surface methodology. Journal of the
Science of Food and Agriculture, 89(14), 2428�2434.

Bu, G.H., Luo, Y.K., Lu, J., & Zhang, Y. (2010). Reduced antigenicity of b lactoglobulin by
conjugation with glucose through controlled Maillard reaction conditions. Food and
Agricultural Immunology, 21(2), 143�156.

Bu, G.H., Luo, Y.K., Zhang, Y., & Chen, F.S. (2010). Effects of fermentation by lactic acid
bacteria on the antigenicity of bovine whey proteins. Journal of the Science of Food and
Agriculture, 90(12), 2015�2020.

Bu, G.H., Luo, Y.K., Zheng, Z., & Zheng, H. (2009). Effect of heat treatment on the
antigenicity of bovine a-actalbumin and b-lactoglobulin in whey protein isolate. Food and
Agricultural Immunology, 20(3), 195�206.

Chicón, R., López-Fandiño, R., Alonso, E., & Belloque, J. (2008). Proteolytic pattern,
antigenicity, and serum immunoglobulin E binding of b-lactoglobulin hydrolysates obtained
by pepsin and high-pressure treatments. Journal of Dairy Science, 91(3), 928�938.

Ena, J.M., van Beresteijn, E.C.H., Robben, A.J.P.M., & Schmidt, D.G. (1995). Whey protein
antigenicity reduction by fungal proteinases and a pepsin/pancreatic combination. Journal
of Food Science, 60, 104�116.

Fritsche, R. (2003). Role of technology in dairy allergy. Australian Journal of Dairy Technology,
58(2), 89�91.

Hill, D.J., & Hosking, C.S. (1996). Cow milk allergy in infancy and early childhood. Clinical
and Experimental Allergy, 26, 243�246.

Hill, D.J., & Hosking, C.S. (1997). Emerging disease profiles in infants and young children
with food allergy. Pediatric Allergy and Immunology, 8, 21�26.

Hosking, C.S., Heine, R.G., & Hill, D.J. (2000). The Melbourne milk allergy study-two
decades of clinical research. Allergy and Clinical Immunology International, 12(5), 198�205.

Hussein, S. Gelencsér, É. Polgár, M. & Hajós, G.Y.(2000). Effect of enzymatic modification
on the biological activity and nutritive value of cow and buffalo casein. Acta Alimentaria,
29(3), 273�287.

Jost, R., Monti, J.C., & Pahud, J.J. (1987). Whey protein allergenicity and its reduction by
technological means. Food Technology, 11, 118�121.

Kleber, N., & Hinrichs, J. (2007). Antigenic response of b lactoglobulin in thermally treated
bovine skim milk and sweet whey. Milchwissenschaft, 62(2), 121�124.

Table 5. Statistics analysis of correlation between anti-a-casein (or anti-b-casein) IgG binding
inhibition and the DH.

R
2

R
a

P-value

Anti-a-casein IgG binding inhibition 0.191 �0.437** 0.008 B 0.01
Anti-b-casein IgG binding inhibition 0.366 �0.605** 0.000 B 0.01
a
Correlation coefficient.

**significant at 0.01.

Food and Agricultural Immunology 81

Kleber, N., Maier, S., & Hinrichs, J. (2007). Antigenic response of bovine b-lactoglobulin
influenced by ultra-high pressure treatment and temperature. Innovative Food Science and
Emerging Technologies, 8(1), 39�45.

Lieske, B., & Konrad, G. (1996). Interrelation between pH and availability of a-lactalbumin
and b-lactoglobulin for proteolysis by papain. International Dairy Journal, 6(4), 359�370.

Lowry, O.H., Rosebrough, N.J., Farr, A.L., & Randall, R.J. (1951). Protein measurement with
the folin phenol reagent. Journal of Biological Chemistry, 193, 265�275.

Nissen, J.N. (1979). Determination of the degrees of hydrolysis of food protein hydrolysates by
trinitro-benzene-sulfonic acid. Journal of Agriculture and Food Chemistry, 27, 1256�1263.

Wal, J.M. (1998). Cow’s milk allergens-an update on allergens. Allergy, 53, 1013�1022.
Wróblewska, B., Jedrychowski, L., & Farjan, M. (2007). The allergenicity of a low molecular

fraction of cow milk protein hydrolysates. Milchwissenschaft, 62(4), 375�379.
Wróblewska, B., Jedrychowski, L., Hajós, G., & Szabó, E. (2008). Influence of alcalase and

transglutaminase on immunoreactivity of cow milk whey proteins. Czech Journal of Food
Sciences, 26(1), 15�23.

Wróblewska, B., Jedrychowski, L., Szabo, E., & Hajos, G.Y. (2005). The reduction of cow milk
proteins immunoreactivity by two-step enzymatic hydrolysis. Acta Alimentaria, 34(3), 307�
315.

Zheng, H.(2009). Study on the reduction of whey protein antigenicity by mixed proteinase
hydrolysis. Master’s thesis. Retrieved from http://202.112.175.70/tpi_3/sysasp/cnki/main-
frame.asp?dbid=17(23-7-2011)

Zheng, H., Shen, X.Q., Bu, G.H., & Luo, Y.K. (2008). Effects of pH, temperature and enzyme-
to-substrate ratio on the antigenicity of whey protein hydrolysates prepared by Alcalase.
International Dairy Journal, 18(10�11), 1028�1033.

82 X. Liu et al.

http://202.112.175.70/tpi_3/sysasp/cnki/mainframe.asp?dbid=17(23-7-2011)

be copied or emailed to multiple sites or posted to a listserv without the copyright holder’s express written

permission. However, users may print, download, or email articles for individual use.

The globin f

mily is comprised of small porphyrin�

containing proteins that can reversibly bind O2 via an iron

(Fe
2+

) ion of the heme prosthetic group [1]. Hemoglob

(Hb) and myoglobin (Mb) are two members of the globin

family and function in storage and transportation of oxy�

gen in different tissues [2, 3]. However, in some mollusks

and arthropods, Hb is replaced by hemocyanin [4, 5],

which plays important roles in transporting oxygen vi

copper ions [6], homeostatic and physiological processes

such as molting [7], hormone transport [8], osmoregula�

tion, and protein storage [9]. It has been reported that

increasing ambient temperature can lead to decreased

oxygen affinity of hemocyanin and a change in coopera�

tivity of the pigment [10], and low temperature signifi�

cantly downregulates hemocyanin content [11].

esides the well�known Hb and Mb, the other two

globins, cytoglobin (Cygb) and neuroglobin (Ngb), have

also been identified in a wide range of species [12] and

possess the typical globin fold of eight helixes and a heme

prosthetic group whose physiological importance is pri�

marily related to its ability to reversibly bind molecular

oxygen [13]. Ngb is mainly expressed in the cytoplasm of

neurons (brain and retina) and some endocrine tissues

[14]. Several potential functions of Ngb have been report�

ed, such as the detoxification of reactive oxygen species

(ROS) and NO, as well as the role of oxygen sensor and

transporter [15, 16]. Cygb is found in heart, lung, liver,

and stomach [17�19] and shows oxygen�binding charac�

teristics like those of Mb [16], suggesting that Cygb facil�

ISSN 0006�2979, Biochemistry (Moscow), 2017, Vol. 82, No. 7, pp. 844�851. © Pleiades Publishing, Ltd., 2017.

Published in Russian in Biokhimiya, 2017, Vol. 82, No. 7, pp. 1097�1106.

Abbreviations: Cygb, cytoglobin; Hb, hemoglobin; LDH, lac�

tate dehydrogenase; Mb, myoglobin; Ngb, neuroglobin; ROS,

reactive oxygen species; SDH, succinate dehydrogenase.

* To whom correspondence should be addressed.

Effect of Low Temperature on Globin Expression,
Respiratory Metabolic Enzyme Activities,

and Gill Structure of Litopenaeus vannamei

Meng Wu1, Nan Chen1, Chun�Xiao Huang1, Yan He1, Yong�Zhen Zhao2,
Xiao�Han Chen3, Xiu�Li Chen3*, and Huan�Ling Wang1,2*

1Ministry of Education, Huazhong Agricultural University, College of Fishery, Key Lab of Freshwater Animal Breeding,

Key Laboratory of Agricultural Animal Genetics, Breeding, and Reproduction, 430070 Wuhan, PR China;

E�mail: hbauwhl@hotmail.com
2Freshwater Aquaculture Collaborative Innovation Center of Hubei Province, 430070 Wuhan, PR China

3Guangxi Academy of Fishery Sciences, 530021 Nanning, PR China; E�mail: chenxiuli2001@163.com

Received January 22, 2017

Revision received March 20, 2017

Abstract—Low temperature frequently influences growth, development, and even survival of aquatic animals. In the pres�
ent study, physiological and molecular responses to low temperature in Litopenaeus vannamei were investigated. The cDN

sequences of two oxygen�carrying proteins, cytoglobin (Cygb) and neuroglobin (Ngb), were isolated. Protein structure

analysis revealed that both proteins share a globin superfamily domain. Real�time PCR analysis indicated that Cygb and Ng

mRNA levels gradually increased during decrease in temperatures from 25 to 15°C and then decreased at 10°C in muscle,

brain, stomach, and heart, except for a continuing increase in gills, whereas they showed a different expression trend in the

hepatopancreas. Hemocyanin concentration gradually reduced as the temperature decreased. Moreover, the activities of

respiratory metabolic enzymes including lactate dehydrogenase (LDH) and succinate dehydrogenase (SDH) were meas�

ured, and it was found that LDH activity gradually increased while SDH activity decreased after low�temperature treatment.

Finally, damage to gill structure at low temperature was also observed, and this intensified with further decrease in temper�

ature. Taken together, these results show that low temperature has an adverse influence in L. vannamei, which contributes

to systematic understanding of the adaptation mechanisms of shrimp

at low temperature.

DOI: 10.1134/S000629791707010

Keywords: Litopenaeus vannamei, low temperature, Cygb, Ngb, respiratory enzymes, gill structure

RESPONSES OF Litopenaeus vannamei TO LOW TEMPERATURE 845

BIOCHEMISTRY (Moscow) Vol. 82 No. 7 2017

itates O2 diffusion to the respiratory chain. It also func�

tions in scavenging NO and ROS [20]. In addition, recent

studies have demonstrated that temperature influences

the affinity of Cygb and Ngb to O2 [21].

Litopenaeus vannamei, also known as Penaeus van�

namei, which originates from the Pacific coast between

the Gulf of California and Northern Peru, grows at tem�

peratures between 25 and 35°C [22]. This popular cul�

tured shrimp species has experienced a dramatic increase

in aquaculture production from 2,161,008 tons in 2006 to

3,668,682 tons in 2014 [23]. Studies have revealed that

the changes in temperature and oxygen content in differ�

ent altitudes can affect some respiratory metaboli

enzymes in lizards, such as lactate dehydrogenase (LDH)

and succinate dehydrogenase (SDH) [24]. Additionally,

low temperature significantly affects shrimp immune

functions [25], growth [26], metabolic rates [27], and

even survival [28]. However, the physiological and molec�

ular responses to low temperature in L. vannamei based

on analysis of two globins and respiratory metabolic

enzymes are unclear. Therefore, in this study we cloned

and characterized the Cygb and Ngb genes and deter�

mined their expression patterns under different tempera�

ture conditions. The relative respiratory physiological

indexes were also determined.

MATERIALS AND METHODS

Sample collection. Litopenaeus vannamei (5.66 ±
1.02 g, 7.2 ± 0.78 cm) were collected from Guangxi

Fisheries Research Institute, Nanning, China. After accli�

mation for 7 days, the shrimps were randomly divided into

four groups, and each group had three repetitions (n = 15

in each repetition). After the temperature reached the set

values at 12 h by linear cooling, the shrimps were treated

at different temperatures (25 – control, 20, 15, and 10°C)

for 6 h with saturated dissolved oxygen. Then, the shrimps

were anesthetized with MS�222 (150 mg/ liter), sampled,

and stored at –80°C for extraction of total RNA or fixed in

Bouin’s solution for hematoxylin–eosin staining.

Total RNA extraction and cDNA synthesis. Total
RNA was extracted by TRIzol reagent (TaKaRa, Japan)

following the manufacturer’s instructions. RNA concen�

tration was measured using a NanoDrop 2000 instrument

(Thermo Fisher Scientific, USA). First�strand cDNA

was synthesized using a reverse�transcriptase kit

(Promega, USA) as follows: 5 μg of total RNA and 10 μl

of oligo(dT)20 primer (50 pmol) were reacted for 5 min at

70°C. After incubation for 2 min on ice, the mixture was

reverse�transcribed into cDNA at 42°C for 60 min in a

volume of 25 μl containing 1 μl of 5× M�MLV buffer, 2 μl
dNTPs, 200 units of M�MLV reverse transcriptase, and

40 units RNasin.

Gene cloning. The primers used for amplifying the core
sequence of Cygb were designed based on the EST sequence

of L. vannamei (FE137590.1). The degenerate primers used

for amplifying the core sequence of Ngb were designed in

conserved regions of homologs in Cherax destructor

(KP299991.1), Cephus cinctus (XM_015731629.1), and

Neodiprion lecontei (XM_015663169.1). The 3′� and 5′�end
sequences were amplified based on an efficient full�length

Primer name

Cygb�F

Cygb�R1

Ngb�F1
Ngb�R1

AD1
AD

AD3

Cygb�3utr�1
Cygb�3utr�2
Cygb�5utr�1
Cygb�5utr�2
Cygb�5utr�3

Ngb�3utr�1
Ngb�3utr�2

Cygb�Qpcr�F
Cygb�Qpcr�R

Ngb�Qpcr�F
Ngb�Qpcr�R

Application

amplifying the core sequence of Cygb

amplifying the core sequence of Ngb

TAIL�PCR for amplifying UTR of Ngb

amplifying UTR of Cygb

Ngb primers for UTR

Cygb primers for qRT�PCR

Ngb primers for qRT�PCR

Primers used for PCR and mRNA expression

Primer sequence (5′�3′)

GGTTGGTGGACTGCTGG
GGCGTTTATTCGTCTTCA

GGCCACGTCCATGGAGCTGGCNGARCACG
CCAGGAAGGGCTTCTCGATYTTCCARAA

NTCGASTWTSGWGTT
NGTCGASWGANAWGAA
WGTGNAGWANCANAGA

CTGCCTGGTGGAAATGCTGAACGCTAC
ACTGAAGACGAATAAACGCCTTGCTGC
TCGCCCTCAGGACCCAGGTCACCGTCTT
AGAAGACTCCACATTGCTCCCATCGTCT
AGTCCCAGCAGTCCACCAACCCCACAGA

ACTTCTTCTTCGACCTCCTGCACCAGAT
ATCCCAGGGTTCAAGAAGGAGTATTTTT

AGGTGAGCAGCGTCCAGT
CAGCAAGGCGTTTATTCGT

CAGGGTTCAAGAAGGAGT
TGATGGTTATGCGGTAGA

846 MENG WU et al.

BIOCHEMISTRY (Moscow) Vol. 82 No. 7 2017

cDNA amplification strategy with modified nested�PCR

and thermal asymmetric interlaced (TAIL) PCR [29]. All

the primer information is shown in the table. After these

PCR products were cloned into pGEM�T Easy vector and

sequenced, the full�length or partial cDNA sequences of

Cygb and Ngb were assembled by the DNAStar software,

respectively.

Sequence analysis. The amino acid sequences of L.
vannamei Cygb and Ngb were predicted using Open

Reading Frame Finder on the NCBI database (http://www.

ncbi.nlm.nih.gov./grof/gorf.html). Homologous analysis

and multiple alignment of amino acid sequences were

achieved using BLAST and BLASTX on the NCBI data�

base (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The phy�

logenetic tree was constructed by the neighbor�joining

method using the MEGA 5.0 package. The protein

domains were noted according to the UniProt (http://www.

uniprot.org) and SMART (http://smart.embl�heidelberg.

de) databases.

Quantitative real�time PCR (qRT�PCR). The tran�
scription levels of Ngb and Cygb in different tissues of L.

vannamei after low�temperature treatment were deter�

mined by qRT�PCR. The primer sequences are shown in

the table. The qRT�PCR was carried out in 20�μl total

reaction volume containing 10 μl of 2× SYBR Green PCR
Master Mix (Takara), 0.8 μl of each primer, 7.4 μl of H2O,

and 1 μl of cDNA template. The following three�step

reaction was performed at 95°C for 5 min, followed by

cycles at 95°C for 10 s, 60°C for 10 s, and 72°C for 20 s.

The melting curve was analyzed to demonstrate the speci�

ficity of the PCR reaction. The β�actin gene was chosen as
the internal reference gene. All samples from each group

were examined in triplicate on the same plate. The relative

expression of Ngb and Cygb was calculated using the com�

parative Ct method with the formula 2
–ΔΔCt

[30].

Hematoxylin–eosin (HE) staining. The gills of L.
vannamei from the different groups fixed in Bouin’s solu�

tion were embedded in paraffin after a series of dehydra�

Fig. 1. Effect of temperature on gill structure of L. vannamei. Thick arrows, short arrows, and thin arrows, respectively, represent epithelium
cells, cuticle membrane, and lymphocyte.

RESPONSES OF Litopenaeus vannamei TO LOW TEMPERATURE 847

BIOCHEMISTRY (Moscow) Vol. 82 No. 7 2017

tions steps in a gradient of alcohol and hyalinization in

xylene. Paraffin blocks of specimen were cut into contin�

uous 5�μm sections and then stained with HE. Finally,

the gill structure was observed under an optical micro�

scope.

Hemocyanin measurement. Hemolymph was with�
drawn from the shrimp cardio coelom with a 1�ml syringe

filled with an equal volume of anticoagulant solution

(30 mM trisodium citrate including 0.34 M NaCl, 10 mM

EDTA, and 0.115 M glucose, pH 7.55) and then quickly

transferred to precooled microcentrifuge tubes. Anti�

coagulant hemolymph was centrifuged at 800g for 10 min

at 4°C. Then 100 μl of supernatant was diluted (1 : 30)

with Tris�Ca buffer (50 mM Tris�HCl, 10 mM CaCl2, pH

8.0). The absorbance values of the diluted plasma were

measured at 334 nm using a UV spectrophotometer, and

hemocyanin concentration (mM) was calculated using

the following formula: E334 (mM) = 2.69 × OD334 (E
stands for hemocyanin) [31].

Activity assay of SDH and LDH. Total proteins in
gill, muscle, and hepatopancreas tissues were extracted by

the tissue homogenate method and determined for con�

centration based on the BCA method. The SDH and

LDH activities were measured using the SDH and LDH

activity assay kits (Nanjing Jiancheng Bioengineering

Institute, Nanjing, China) according to the supplier’s

instructions. Briefly, the SDH activity was measured

spectrophotometrically at 600 nm by the rate of 2,6�

dichlorophenolindophenol reduction coupled with oxi�

dation of FADH (the product of the SDH reaction).

LDH can produce reddish�brown pyruvate dinitroben�

zene hydrazine through a series of reaction, and thus the

LDH activity was determined using lactic acid and 2,4�

dinitrophenylhydrazine based on the Beer–Lambert law.

Statistical analysis. The data were statistically ana�
lyzed by one�way analysis of variance (one�way ANOVA)

followed by Duncan’s multiple range tests using the SPSS

16.0 software (SPSS Inc., USA). Data are presented as

mean ± S.D; p < 0.05 is taken as statistically significant.

RESULTS

Low temperature damaged gill structure of L. van�
namei. To analyze the effect of low temperature on the
respiratory organ of L. vannamei, the gill structure was

observed. In the study, the shrimps moved more slowly as

the temperature decreased. The gill filaments at the nor�

mal temperature of 25°C were arranged in a neat, clear

structure, and blood cells in the hemocoel were also

observed (Fig. 1). However, after the temperature

decreased, the gill filaments swelled and were somewhat

randomly arranged. Additionally, a significant cell rup�

ture was also observed in the gill filament at low temper�

ature. The degree of damage to the gill structure was fur�

ther intensified as the temperature decreased (Fig. 1).

Low temperature affected activities of SDH and LDH
and hemocyanin concentration. To analyze the changes of
aerobic and anaerobic respiration in shrimp at low temper�

atures, the relative respiratory physiological indexes were

also determined. The LDH activity showed gradually

increased trend in the gill, muscle, and hepatopancreas with

temperature decrease, except for a decrease at 10°C in mus�

cle and hepatopancreas (Fig. 2A). The SDH activity gradu�

ally decreased and reached the lowest value at 10°C in gill,

muscle, and hepatopancreas (Fig. 2B). The hemocyanin

concentration in the hemolymph was measured at different

temperatures, and the results revealed that hemocyanin

gradually decreased as the temperature decreased (Fig. 3).

Sequence analysis of L. vannamei Cygb and Ngb.
Cygb and Ngb participate in several processes such as

oxygen sensing and transport, ROS scavenging, etc.

However, there are few studies on Cygb and Ngb in

shrimp. Therefore, the cDNA sequences of the two genes

were determined in this study. The full�length cDNA of

Cygb consisted of 1059 bp (GenBank accession number

KX839668) including a 173�bp 5′�UTR, a 313�bp 3′�

Fig. 2. Effect of temperature on SDH (A) and LDH (B) activities
of L. vannamei. Different letters indicate significant differences at

level

p < 0.05.

4000

3000

2000

1000

Gill Muscle Hepatopancreas

S
D

H
a

c
ti

vi
ty

,
U

/g
p

ro
te

0
Gill Muscle Hepatopancreas
A
ab

b
b

b b

a
a

a
a
a
a
a

bc
ac

c
c
c
b
b

25 °С 20 °С 15 °С 10 °С

L
D

H
a
c
ti
vi
ty
,
U
/g
p
ro
te
in

848 MENG WU et al.

BIOCHEMISTRY (Moscow) Vol. 82 No. 7 2017

UTR with a polyA signal sequence, and a 573�bp open

reading frame (ORF). The predicted protein consisted of

190 a.a. with molecular weight of 21.2 kDa and predicted

isoelectric point of 5.57. We attempted to obtain the 5′�
UTR and partial coding sequences of Ngb, but failed; so,

only the partial cDNA sequence (892 bp, GenBank

accession number KX839669) was obtained, including a

528�bp coding sequence and a 364�bp 3′�UTR. Multiple
sequence alignment of Ngb and Cygb amino acid

sequences of L. vannamei with other species revealed the

presence of a shared globin superfamily domain.

The phylogenetic tree with the amino acid sequences

of Mb, Cygb, and Ngb (three members of the globin fam�

ily) was constructed. The result showed that the three glo�

bins generally fell into three distinct clades, where Mb

and Cygb were first clustered into one branch, and then

clustered with Ngb.

Effect of low temperature on L. vannamei Cygb and
Ngb expression. To analyze the effect of low temperature
on L. vannamei Cygb and Ngb expression, qRT�PCR was

performed. The Cygb and Ngb genes were constitutively

expressed in the detected tissues of L. vannamei at the

normal temperature of 25°C. The Cygb mRNA expression

gradually increased with temperature decrease from 25 to

15°C and then decreased at 10°C in muscle, brain, stom�

ach, and heart. In the gill, the expression gradually

increased, but in the hepatopancreas there was no signif�

icant change with decrease in temperature (Fig. 4A). The

Ngb mRNA level showed a similar expression trend with

Cygb expression in muscle, brain, stomach, and heart. In

the hepatopancreas and gill, the Ngb expression increased

at 20°C, decreased to the lowest level at 15°C, and then

increased at 10°C (Fig. 4B).

DISCUSSION

Temperature is one of the most important environ�

mental factors, and its change has striking effects on

many physiological processes in aquatic organisms. For

example, temperature stress can induce ROS and signifi�

cantly influence metabolism, growth, and survival [32,

33]. Our study investigated the physiological and molec�

ular responses to low temperature in L. vannamei.

Low temperature influenced gill structure in L. van�
namei. The gill is a multifunctional organ involved in a
wide variety of physiological functions, including oxygen

uptake, carbon dioxide release, osmoregulation, nitrogen

excretion, hormone metabolism, etc. [34]. It has been

revealed that when the temperature is changed, the gills

show uneven arrangement, hyperplasia, and hypertrophy

[35]. In this study, low temperature caused swelling and

malalignment of the gills. Additionally, the hemolymph

cells in the gill hemocoel also swelled and were even bro�

ken. This phenomenon became more and more serious

with the decrease in temperature. It was suggested that

the damage of gill structure and the rupture of

hemolymph cells probably affected oxygen uptake in the

gill, which was similar with the previous studies that the

gill tissue of Penaeus japonicus can be destroyed and the

hemolymph function for oxygen transportation reduced

after ammonia�N stress [36].

Low temperature induces transition of aerobic respi�
ration to anaerobic. SDH is an important enzyme in aer�
obic metabolism and is involved in both the citric acid

cycle and the respiratory electron transfer chain [37]. Its

activity can roughly reflect the level of aerobic metabo�

lism [38]. LDH can catalyze the conversion of pyruvate

and lactic acid and is regarded as a marker of anaerobic

metabolism [39]. Our results showed an increasing trend

for LDH activities but decrease for SDH activities with

decrease in temperature, indicating that aerobic metabo�

lism of L. vannamei was probably weakened instead of the

enhancement of anaerobic metabolism. Similarly, hypox�

ia can result in downregulation of aerobic metabolism

[40]. Low temperature and hypoxia at high altitude also

leads to decrease in LDH and increase in SDH [24, 41].

On the other hand, in our study the hemocyanin content

was gradually reduced as the temperature decreased,

which was similar with a previous study in shrimp [11].

Hemocyanin, a respiratory protein, is a major protein

component of shrimp hemolymph, c.a. from 50 to >90%
[42], and plays an important role in binding and trans�

porting O2 and CO2 [43]. Therefore, its decrease may

indicate a decrease in oxygen uptake in shrimp.

Combined with these results, it is reasonable to presume

that the changes in LDH and SDH were caused by respi�

ratory disorder under low�temperature conditions.

Low temperature affected the expression of Cygb and
Ngb. Globins usually bind an oxygen molecule between
the iron ion of the porphyrin ring and a histidine of the

Fig. 3. Effect of temperature on hemocyanin concentrations of L.
vannamei. Different letters indicate significant differences at level

p < 0.05.

ab
H

e
m

o
c

ya
n

in
c

o
n

c
e

n
tr

a
ti

o
n

,
m

M
/L

0.6

0.4

0.2

0
b
a
c

25 °С 20 °С 15 °С 10 °С

RESPONSES OF Litopenaeus vannamei TO LOW TEMPERATURE 849

BIOCHEMISTRY (Moscow) Vol. 82 No. 7 2017

polypeptide chain. Crystal structures suggest that these

globins are heme�containing proteins [18, 44]. To analyze

the effect of temperature on globin expression, here two

members, Cygb and Ngb, were obtained from L. van�

namei. The multiple alignments indicated that Cygb was

evolutionarily non�conserved in crustaceans due to only

62% of even with C. destructor. The phylogenetic tree

showed that Cygb was first clustered with Mb and then

into a large branch with Ngb, indicating that Cygb and

Mb have a closer evolutionary relationship and separated

from each other more than 450 million years ago [45].

Furthermore, Cygb and Mb shared several key amino

acid residues that are important for the structure and

function of all hemoproteins [19, 46].

Cygb and Ngb participate in several processes such

as oxygen sensing and transport and ROS scavenging [16,

47]. In this study, the expression of Cygb and Ngb roughly

increased in muscle, brain, stomach, heart, and gill in

response to low temperature, which was similar with pre�

vious studies indicating that some environment factors

such as hypoxia and oxidative stress induce upregulated

expression of globins including Cygb, Ngb, and Mb [17,

48�50]. Therefore, a similar potential function of Cygb

and Ngb in protecting shrimp from hypoxia injury caused

by respiratory disorder was also conceivable for L. van�

namei under low temperature stress. The expression levels

in most tissues including muscle, brain, stomach, and

heart decreased at 10°C as a result of the organism’s adap�

Fig. 4. Expression patterns of Cygb (A) and Ngb (B) in different tissues of L. vannamei at different temperatures determined using qRT�PCR.
Different letters above bars represent significant difference among different groups with different temperatures in the same tissue (p < 0.05), and the same letters above bars indicate no significant difference.

GillMuscle Hepatopancreas

T
h

e
r

e
la

ti
ve

e
xp

re
s

s
io

n
o

f
C

g
b

ab
bb

b
b
b
a
a

b
a

a
a
a
a
ab
bc

ccc b

25 °С 20 °С 15 °С 10 °С

b
b b

b
b
b
b
b
b
b
a
a

Brain Stomach Heart

4
2
1

0.5

0.25

0.125

b b

bab

b
c

c
b
a
a

GillMuscle HepatopancreasBrain Stomach Heart

T
h
e
r
e
la
ti
ve
e
xp
re
s
s
io
n
o

f
N

g
b
32
16
8
4
2
1
0.5
0.25
a

850 MENG WU et al.

BIOCHEMISTRY (Moscow) Vol. 82 No. 7 2017

tation. The expression in the gill was still increasing at

10°C, which may be due to direct low temperature stress.

There was no significant change in the expression of Cygb

in hepatopancreas, which may be caused by the coopera�

tion of oxygen and ROS content in the organism, but the

mechanisms are still unclear.

In summary, low temperature damaged gill tissue,

which affects the transport of oxygen, resulting in changes

of respiratory related physiological indexes and the corre�

sponding regulation of globin genes. These results will

contribute to provide a reference for systematic under�

standing of the response mechanism of shrimp respiration

at low temperature.

Acknowledgments

This study was supported by the open fund of

Guangxi Key Laboratory of Aquatic Genetic Breeding

and Healthy Aquaculture.

REFERENCES

1. Weber, R. E., and Vinogradov, S. N. (2001) Nonvertebrate

hemoglobins: functions and molecular adaptations,

Physiol. Rev., 81, 569�628.
2. Brunori, M. (2001) Nitric oxide, cytochrome c oxidase and

myoglobin, Trends Biochem. Sci., 26, 21�23.
3. Bunn, H. F. (1981) Evolution of mammalian hemoglobin

function, Blood, 58, 189�197.
4. Decker, H., and Jaenicke, E. (2004) Recent findings on

phenoloxidase activity and antimicrobial activity of hemo�

cyanins, Dev. Comp. Immunol., 28, 673�687.
5. Pick, C., Hagner�Holler, S., and Burmester, T. (2008)

Molecular characterization of hemocyanin and hexamerin

from the firebrat Thermobia domestica (Zygentoma), Insect

Biochem. Molec., 38, 977�983.
6. Pan, J. Y., Zhang, Y. L., Wang, S. Y., and Peng, X. X. (2008)

Dodecamer is required for agglutination of Litopenaeus

vannamei hemocyanin with bacterial cells and red blood

cells, Mar. Biotechnol., 10, 645�652.
7. Glazer, L., Tom, M., Weil, S., Roth, Z., Khalaila, I.,

Mittelman, B., and Sagi, A. (2013) Hemocyanin with phe�

noloxidase activity in the chitin matrix of the crayfish gas�

trolith, J. Exp. Biol., 216, 1898�1904.
8. Jaenicke, E., Föll, R., and Decker, H. (1999) Spider hemo�

cyanin binds ecdysone and 20�OH�ecdysone, J. Biol.

Chem., 274, 34267�34271.
9. Paul, R., and Pirow, R. (1998) The physiological signifi�

cance of respiratory proteins in invertebrates, Zoology, 100,
298�306.

10. Zielinski, S., Sartoris, F. J., and Pörtner, H. O. (2001)

Temperature effects on hemocyanin oxygen binding in an

Antarctic cephalopod, Biol. Bull., 200, 67�76.
11. Fan, L., Wang, A., and Wu, Y. (2013) Comparative pro�

teomic identification of the hemocyte response to cold

stress in white shrimp, Litopenaeus vannamei, J. Proteomics,

80, 196�206.

12. Vinogradov, S. N., Hoogewijs, D., Bailly, X., Arredondo�

Peter, R., Gough, J., Dewilde, S., Moens, L., and

Vanfleteren, J. R. (2006) A phylogenomic profile of globins,

BMC Evol. Biol., 6, 31.
13. Bjørlykke, G. A., Kvamme, B. O., Slinde, E., and Raae, A.

J. (2012) Cloning, expression and purification of Atlantic

salmon (Salmo salar L.) neuroglobin, Protein Expres. Purif.,

86, 151�156.
14. Zhu, Y., Sun, Y., Jin, K., and Greenberg, D. A. (2002)

Hemin induces neuroglobin expression in neural cells,

Blood, 100, 2494�2498.
15. Burmester, T., and Hankeln, T. (2004) Neuroglobin: a respi�

ratory protein of the nervous system, Physiology, 19, 110�113.
16. Pesce, A., Bolognesi, M., Bocedi, A., Ascenzi, P., Dewilde,

S., Moens, L., and Burmester, T. (2002) Neuroglobin and

cytoglobin, EMBO Rep., 3, 1146�1151.
17. Fordel, E., Geuens, E., Dewilde, S., Rottiers, P.,

Carmeliet, P., Grooten, J., and Moens, L. (2004)

Cytoglobin expression is upregulated in all tissues upon

hypoxia: an in vitro and in vivo study by quantitative real�

time PCR, Biochem. Biophys. Res. Commun., 319, 342�348.
18. Sanctis, D., Dewilde, S., Pesce, A., Moens, L., Ascenzi, P.,

Hankeln, T., Burmester, T., and Bolognesi, M. (2004)

Crystal structure of cytoglobin: the fourth globin type dis�

covered in man displays heme hexa�coordination, J. Mol.

Biol., 336, 917�927.
19. Schmidt, M., Gerlach, F., Avivi, A., Laufs, T., Wystub, S.,

Simpson, J. C., Nevo, E., Saaler�Reinhardt, S., Reuss, S.,

and Burmester, T. (2004) Cytoglobin is a respiratory protein

in connective tissue and neurons, which is up�regulated by

hypoxia, J. Biol. Chem., 279, 8063�8069.
20. Hankeln, T., Ebner, B., Fuchs, C., Gerlach, F.,

Haberkamp, M., Laufs, T. L., Roesner, A., Schmidt, M.,

Weich, B., and Wystub, S. (2005) Neuroglobin and cyto�

globin in search of their role in the vertebrate globin family,

J. Inorg. Biochem., 99, 110�119.
21. Fago, A., Hundahl, C., Dewilde, S., Gilany, K., Moens, L.,

and Weber, R. E. (2004) Allosteric regulation and tempera�

ture dependence of oxygen binding in human neuroglobin

and cytoglobin – molecular mechanisms and physiological

significance, J. Biol. Chem., 279, 44417�44426.
22. Menz, A., and Bowers, A. B. (1980) Bionomics of Penaeus

vannamei Boone and Penaeus stylirostris Stimpson in a

lagoon on the Mexican Pacific Coast, Estuar. Coast. Shelf,

10, 685�697.
23. FAO Year Book: Fishery and Aquaculture Statistics (2016)

FAO, Rome.

24. He, J., Xiu, M., Tang, X., Yue, F., Wang, N., Yang, S., and

Chen, Q. (2013) The different mechanisms of hypoxic

acclimatization and adaptation in lizard Phrynocephalus

vlangalii living on Qinghai�Tibet plateau, J. Exp. Zool. Part

A, 319, 117�123.
25. Qiu, J., Wang, W. N., Wang, L. J., Liu, Y. F., and Wang, A. L.

(2011) Oxidative stress, DNA damage and osmolality in the

Pacific white shrimp Litopenaeus vannamei exposed to acute

low temperature stress, Comp. Biochem. Phys. C, 154, 36�41.
26. Wyban, J., Walsh, W. A., and Godin, D. M. (1995)

Temperature effects on growth, feeding rate and feed con�

version of the Pacific white shrimp (Penaeus vannamei),

Aquaculture, 138, 267�279.
27. Villarreal, H., and Ocampo, L. (1993) Effect of size and

temperature on the oxygen consumption of the brown

RESPONSES OF Litopenaeus vannamei TO LOW TEMPERATURE 851

BIOCHEMISTRY (Moscow) Vol. 82 No. 7 2017

shrimp Penaeus californiensis (Holmes, 1900), Comp.

Biochem. Phys. A, 106, 97�101.
28. Paz, P. E., Roy, L. A., Davis, D. A., and Quintero, H. E.

(2011) Survival of post�larval Litopenaeus vannamei follow�

ing acclimation to low salinity waters at different tempera�

tures, J. World Aquacult. Soc., 42, 575�579.
29. Chen, N., Wang, W. M., and Wang, H. L. (2016) An effi�

cient full�length cDNA amplification strategy based on

bioinformatics technology and multiplexed PCR methods,

Sci. Rep., 5, 19420.
30. Livak, K. J., and Schmittgen, T. D. (2001) Analysis of rela�

tive gene expression data using real�time quantitative PCR

and the 2
−ΔΔCT

method, Methods, 25, 402�408.
31. Nickerson, K. W., and VanHolde, K. E. (1971) A compari�

son of molluscan and arthropod hemocyanin. I. Circular

dichroism and absorption spectra, Comp. Biochem. Phys. B,

39, 855�872.
32. An, M. I., and Choi, C. Y. (2010) Activity of antioxidant

enzymes and physiological responses in ark shell,

Scapharca broughtonii, exposed to thermal and osmotic

stress: effects on hemolymph and biochemical parameters,

Comp. Biochem. Phys. B, 155, 34�42.
33. Lushchak, V. I., and Bagnyukova, T. V. (2006) Temperature

increase results in oxidative stress in goldfish tissues. 2.

Antioxidant and associated enzymes, Comp. Biochem. Phys.

C, 143, 36�41.
34. Evans, D. H., Piermarini, P. M., and Choe, K. P. (2005)

The multifunctional fish gill: dominant site of gas

exchange, osmoregulation, acid�base regulation, and

excretion of nitrogenous waste, Physiol. Rev., 85, 97�177.
35. Salazar�Lugo, R., Mata, C., Oliveros, A., Rojas, L. M.,

Lemus, M., and Rojas�Villarroel, E. (2011)

Histopathological changes in gill, liver and kidney of

neotropical fish Colossoma macropomum exposed to

paraquat at different temperatures, Environ. Toxicol. Phar.,

31, 490�495.
36. Chen, J. C., Cheng, S. Y., and Chen, C. T. (1994) Changes

of haemocyanin, protein and free amino acid levels in the

haemolymph of Penaeus japonicus exposed to ambient

ammonia, Comp. Biochem. Phys. A, 109, 339�347.
37. Rutter, J., Winge, D. R., and Schiffman, J. D. (2010)

Succinate dehydrogenase assembly, regulation and role in

human disease, Mitochondrion, 10, 393�401.
38. Simon, L. M., and Robin, E. D. (1971) Relationship of

cytochrome oxidase activity to vertebrate total and organ

oxygen consumption, Int. J. Biochem. Cell B, 2, 569�573.

39. Viru, M. (1994) Differences in effects of various training

regimens on metabolism of skeletal muscles, J. Sports Med.

Phys. Fit., 34, 217�227.
40. Hicks, J. W., and Wang, T. (2004) Hypometabolism in rep�

tiles: behavioural and physiological mechanisms that

reduce aerobic demands, Resp. Physiol. Neurobiol., 141,
261�271.

41. Punkt, K., Adams, V., Linke, A., and Welt, K. (1997) The

correlation of cytophotometrically and biochemically

measured enzyme activities: changes in the myocardium

of diabetic and hypoxic diabetic rats, with and without

Ginkgo biloba extract treatment, Acta Histochem., 99, 291�
299.

42. Coates, C. J., Bradford, E. L., Krome, C. A., and Nairn, J.

(2012) Effect of temperature on biochemical and cellular

properties of captive Limulus polyphemus, Aquaculture, 334,
30�38.

43. Coates, C. J., and Nairn, J. (2014) Diverse immune func�

tions of hemocyanins, Dev. Comp. Immunol., 45, 43�55.
44. Sugimoto, H., Makino, M., Sawai, H., Kawada, N.,

Yoshizato, K., and Shiro, Y. (2004) Structural basis of

human cytoglobin for ligand binding, J. Mol. Biol., 339,
873�885.

45. Kugelstadt, D., Haberkam, M., Hankeln, T., and

Burmester, T. (2004) Neuroglobin, cytoglobin, and a novel,

eye�specific globin from chicken, Biochem. Biophys. Res.

Commun., 325, 719�725.
46. Garry, D. J., Kanatous, S. B., and Mammen, P. P. (2003)

Emerging roles for myoglobin in the heart, Trends

Cardiovasc. Med., 13, 111�116.
47. Fang, J., Ma, I., and Allalunis�Turner, J. (2011)

Knockdown of cytoglobin expression sensitizes human

glioma cells to radiation and oxidative stress, Radiat. Res.,

176, 198�207.
48. Fordel, E., Thijs, L., Martinet, W., Lenjou, M., Laufs, T.,

VanBockstaele, D., Moens, L., and Dewilde, S. (2006)

Neuroglobin and cytoglobin overexpression protects

human SH�SY5Y neuroblastoma cells against oxidative

stress�induced cell death, Neurosci. Lett., 410, 146�151.
49. Guo, X., Philipsen, S., and Tan�Un, K. C. (2007) Study of

the hypoxia�dependent regulation of human Cygb gene,

Biochem. Biophys. Res. Commun., 364, 145�150.
50. Tiedke, J., Cubuk, C., and Burmester, T. (2013)

Environmental acidification triggers oxidative stress and

enhances globin expression in zebrafish gills, Biochem.

Biophys. Res. Commun., 441, 624�629.

2017-07-07T10:56:40+0300
Preflight Ticket Signature

What Will You Get?

We provide professional writing services to help you score straight A’s by submitting custom written assignments that mirror your guidelines.

Premium Quality

Get result-oriented writing and never worry about grades anymore. We follow the highest quality standards to make sure that you get perfect assignments.

Experienced Writers

Our writers have experience in dealing with papers of every educational level. You can surely rely on the expertise of our qualified professionals.

On-Time Delivery

Your deadline is our threshold for success and we take it very seriously. We make sure you receive your papers before your predefined time.

24/7 Customer Support

Someone from our customer support team is always here to respond to your questions. So, hit us up if you have got any ambiguity or concern.

Complete Confidentiality

Sit back and relax while we help you out with writing your papers. We have an ultimate policy for keeping your personal and order-related details a secret.

Authentic Sources

We assure you that your document will be thoroughly checked for plagiarism and grammatical errors as we use highly authentic and licit sources.

Moneyback Guarantee

Still reluctant about placing an order? Our 100% Moneyback Guarantee backs you up on rare occasions where you aren’t satisfied with the writing.

Order Tracking

You don’t have to wait for an update for hours; you can track the progress of your order any time you want. We share the status after each step.

Order Now Talk to Us

Areas of Expertise

Although you can leverage our expertise for any writing task, we have a knack for creating flawless papers for the following document types.

Essay

Thesis

Presentation

Dissertation

Term Paper

Research Paper

Book Review

Assignment

Report

Case Study

Letter

Article

Coursework

Speech

Q & A

Critical Thinking

Areas of Expertise

Although you can leverage our expertise for any writing task, we have a knack for creating flawless papers for the following document types.

Essay

Thesis

Presentation

Dissertation

Term Paper

Research Paper

Book Review

Assignment

Report

Case Study

Letter

Article

Coursework

Speech

Q & A

Critical Thinking

Trusted Partner of 9650+ Students for Writing

From brainstorming your paper's outline to perfecting its grammar, we perform every step carefully to make your paper worthy of A grade.

Preferred Writer

Hire your preferred writer anytime. Simply specify if you want your preferred expert to write your paper and we’ll make that happen.

Grammar Check Report

Get an elaborate and authentic grammar check report with your work to have the grammar goodness sealed in your document.

One Page Summary

You can purchase this feature if you want our writers to sum up your paper in the form of a concise and well-articulated summary.

Plagiarism Report

You don’t have to worry about plagiarism anymore. Get a plagiarism report to certify the uniqueness of your work.

Free Features $66FREE

Most Qualified Writer $10FREE
Plagiarism Scan Report $10FREE
Unlimited Revisions $08FREE
Paper Formatting $05FREE
Cover Page $05FREE
Referencing & Bibliography $10FREE
Dedicated User Area $08FREE
24/7 Order Tracking $05FREE
Periodic Email Alerts $05FREE

Our Services

Join us for the best experience while seeking writing assistance in your college life. A good grade is all you need to boost up your academic excellence and we are all about it.

On-time Delivery
24/7 Order Tracking
Access to Authentic Sources

Academic Writing

We create perfect papers according to the guidelines.

Professional Editing

We seamlessly edit out errors from your papers.

Thorough Proofreading

We thoroughly read your final draft to identify errors.

Thorough Proofreading

We thoroughly read your final draft to identify errors.

Delegate Your Challenging Writing Tasks to Experienced Professionals

Work with ultimate peace of mind because we ensure that your academic work is our responsibility and your grades are a top concern for us!

Check Out Our Sample Work

Dedication. Quality. Commitment. Punctuality

It May Not Be Much, but It’s Honest Work!

Here is what we have achieved so far. These numbers are evidence that we go the extra mile to make your college journey successful.

0+

Happy Clients

0+

Words Written This Week

0+

Ongoing Orders

0%

Customer Satisfaction Rate

Process as Fine as Brewed Coffee

We have the most intuitive and minimalistic process so that you can easily place an order. Just follow a few steps to unlock success.

Call Us +1 (877) 657-8180 Discuss Order Details Now

See How We Helped 9000+ Students Achieve Success

We Analyze Your Problem and Offer Customized Writing

We understand your guidelines first before delivering any writing service. You can discuss your writing needs and we will have them evaluated by our dedicated team.

Clear elicitation of your requirements.
Customized writing as per your needs.

We Mirror Your Guidelines to Deliver Quality Services

We write your papers in a standardized way. We complete your work in such a way that it turns out to be a perfect description of your guidelines.

Proactive analysis of your writing.
Active communication to understand requirements.

We Handle Your Writing Tasks to Ensure Excellent Grades

We promise you excellent grades and academic excellence that you always longed for. Our writers stay in touch with you via email.

Thorough research and analysis for every order.
Deliverance of reliable writing service to improve your grades.

Place an Order Start Chat Now

Lab Report

What Will You Get?

Premium Quality

Experienced Writers

On-Time Delivery

24/7 Customer Support

Complete Confidentiality

Authentic Sources

Moneyback Guarantee

Order Tracking

Areas of Expertise

Essay

Thesis

Presentation

Dissertation

Term Paper

Research Paper

Book Review

Assignment

Report

Case Study

Letter

Article

Coursework

Speech

Q & A

Critical Thinking

Areas of Expertise

Essay

Thesis

Presentation

Dissertation

Term Paper

Research Paper

Book Review

Assignment

Report

Case Study

Letter

Article

Coursework

Speech

Q & A

Critical Thinking

Trusted Partner of 9650+ Students for Writing

Preferred Writer

Grammar Check Report

One Page Summary

Plagiarism Report

Free Features $66FREE

Our Services

Academic Writing

Professional Editing

Thorough Proofreading

Thorough Proofreading

Delegate Your Challenging Writing Tasks to Experienced Professionals

Check Out Our Sample Work

It May Not Be Much, but It’s Honest Work!

0+

Happy Clients

0+

Words Written This Week

0+

Ongoing Orders

0%

Customer Satisfaction Rate

Process as Fine as Brewed Coffee

Share Your Requirements

Place Order & Deposit Funds

Release Payment to Your Writer

See How We Helped 9000+ Students Achieve Success

We Analyze Your Problem and Offer Customized Writing

We Mirror Your Guidelines to Deliver Quality Services

We Handle Your Writing Tasks to Ensure Excellent Grades