DNA Replication/ Protein Synthesis and Mutations

DNA Replication/ Protein Synthesis
and Mutations

Fill in the blanks:

Don't use plagiarized sources. Get Your Custom Essay on
DNA Replication/ Protein Synthesis and Mutations
Just from $13/Page
Order Essay

1. The mispairing or substitution of a single base is called a _____________________ mutation.
2. If an event results in the deletion of a nucleotide in the DNA, it is called a ____________________ mutation that results in a ___________________ protein.
3. The _____________, an enzyme, unzippers the DNA during replication.
4. In Eukaryotes the mRNA transcript is derived by removing____________ and splicing the ————–.
5. Exposure to _________ will result in translocations of the DNA in any type of cell.
6. A type of mutation that occurs randomly is called a _______________ mutation whereas one caused by chemicals is an —————– mutation.
7. In an inducible operon, the repressor binds to the ____________ to turn the gene off when not needed.
8. Conjugation requires a __________ to transfer DNA which cells can produce if they have acquired an —————–.
9. During the bacteriophage life cycle, some phage can fragment the host DNA and incorporate any of it into their capsids. They may then infect new host cells. This type of transduction is called ____________.
10. A technology that has lead to the advancement of diagnostic tests has been the fusion of white blood cells that produce monoclonal antibodies and cancer cells. The resulting immortal monoclonal antibody producing cells are called ________________.

Part II—Name that enzyme!

1. synthesizes RNA
2. elongates chains of DNA
3. proofreads DNA chains
4. cuts DNA at specific nucleotide sequences
5. coils or uncoils DNA supercoils
6. binds to the promotor of an operon
7. joins DNA fragments
8. breaks Hydrogen bonds

Protein Synthesis

Directions: Determine the mRNA sequence using the DNA template provided. Then determine the amino acid sequence in the protein using the chart provided.

5’ TACAAAGGACCTTTTAACCCCACT 3’ DNA Template

______________________________________________mRNA

_________________________________________Protein

What Will You Get?

We provide professional writing services to help you score straight A’s by submitting custom written assignments that mirror your guidelines.

Premium Quality

Get result-oriented writing and never worry about grades anymore. We follow the highest quality standards to make sure that you get perfect assignments.

Experienced Writers

Our writers have experience in dealing with papers of every educational level. You can surely rely on the expertise of our qualified professionals.

On-Time Delivery

Your deadline is our threshold for success and we take it very seriously. We make sure you receive your papers before your predefined time.

24/7 Customer Support

Someone from our customer support team is always here to respond to your questions. So, hit us up if you have got any ambiguity or concern.

Complete Confidentiality

Sit back and relax while we help you out with writing your papers. We have an ultimate policy for keeping your personal and order-related details a secret.

Authentic Sources

We assure you that your document will be thoroughly checked for plagiarism and grammatical errors as we use highly authentic and licit sources.

Moneyback Guarantee

Still reluctant about placing an order? Our 100% Moneyback Guarantee backs you up on rare occasions where you aren’t satisfied with the writing.

Order Tracking

You don’t have to wait for an update for hours; you can track the progress of your order any time you want. We share the status after each step.

image

Areas of Expertise

Although you can leverage our expertise for any writing task, we have a knack for creating flawless papers for the following document types.

Areas of Expertise

Although you can leverage our expertise for any writing task, we have a knack for creating flawless papers for the following document types.

image

Trusted Partner of 9650+ Students for Writing

From brainstorming your paper's outline to perfecting its grammar, we perform every step carefully to make your paper worthy of A grade.

Preferred Writer

Hire your preferred writer anytime. Simply specify if you want your preferred expert to write your paper and we’ll make that happen.

Grammar Check Report

Get an elaborate and authentic grammar check report with your work to have the grammar goodness sealed in your document.

One Page Summary

You can purchase this feature if you want our writers to sum up your paper in the form of a concise and well-articulated summary.

Plagiarism Report

You don’t have to worry about plagiarism anymore. Get a plagiarism report to certify the uniqueness of your work.

Free Features $66FREE

  • Most Qualified Writer $10FREE
  • Plagiarism Scan Report $10FREE
  • Unlimited Revisions $08FREE
  • Paper Formatting $05FREE
  • Cover Page $05FREE
  • Referencing & Bibliography $10FREE
  • Dedicated User Area $08FREE
  • 24/7 Order Tracking $05FREE
  • Periodic Email Alerts $05FREE
image

Our Services

Join us for the best experience while seeking writing assistance in your college life. A good grade is all you need to boost up your academic excellence and we are all about it.

  • On-time Delivery
  • 24/7 Order Tracking
  • Access to Authentic Sources
Academic Writing

We create perfect papers according to the guidelines.

Professional Editing

We seamlessly edit out errors from your papers.

Thorough Proofreading

We thoroughly read your final draft to identify errors.

image

Delegate Your Challenging Writing Tasks to Experienced Professionals

Work with ultimate peace of mind because we ensure that your academic work is our responsibility and your grades are a top concern for us!

Check Out Our Sample Work

Dedication. Quality. Commitment. Punctuality

Categories
All samples
Essay (any type)
Essay (any type)
The Value of a Nursing Degree
Undergrad. (yrs 3-4)
Nursing
2
View this sample

It May Not Be Much, but It’s Honest Work!

Here is what we have achieved so far. These numbers are evidence that we go the extra mile to make your college journey successful.

0+

Happy Clients

0+

Words Written This Week

0+

Ongoing Orders

0%

Customer Satisfaction Rate
image

Process as Fine as Brewed Coffee

We have the most intuitive and minimalistic process so that you can easily place an order. Just follow a few steps to unlock success.

See How We Helped 9000+ Students Achieve Success

image

We Analyze Your Problem and Offer Customized Writing

We understand your guidelines first before delivering any writing service. You can discuss your writing needs and we will have them evaluated by our dedicated team.

  • Clear elicitation of your requirements.
  • Customized writing as per your needs.

We Mirror Your Guidelines to Deliver Quality Services

We write your papers in a standardized way. We complete your work in such a way that it turns out to be a perfect description of your guidelines.

  • Proactive analysis of your writing.
  • Active communication to understand requirements.
image
image

We Handle Your Writing Tasks to Ensure Excellent Grades

We promise you excellent grades and academic excellence that you always longed for. Our writers stay in touch with you via email.

  • Thorough research and analysis for every order.
  • Deliverance of reliable writing service to improve your grades.
Place an Order Start Chat Now
image

Order your essay today and save 30% with the discount code Happy