3-4 papes

You have a lot of time (1 week)

Please answer all questions in RED

Biology

PROBLEM SET #2

Part I

To study the control of gene expression in liver and pancreas cells, promoter regions interacting with specific transcription factors were isolated by immunoprecipitation. In an immunoprecipitation, antibodies directed against a specific protein (antigen) are added to a cell extract. In this extract, antigen-antibody interactions will take place. To purify the specific antigen-antibody complexes, a protein (called protein A) conjugated to heavy agarose beads are added to the reaction. Protein A has the ability to bind to the constant region of antibodies. When the reaction is submitted to centrifugation, the heavy beads pellet at the bottom of the centrifugation tube. Therefore, the pellet fraction (P) contains all the components interacting directly or indirectly with protein A: antibody, specific antigen, and molecules bound to the specific antigens. The other components of the reaction mixture remain in the supernatant fraction (S).

1) Figure 1 shows the results of assays where purified and radioactive HNF4 and 6 are mixed and then submitted to immunoprecipiation with anti HNF4 (-HNF4, first 2 lanes) or with anti-HNF6 (-HNF6, last 2 lanes).

Are these two antibodies specific? Explain.

Figure 1: A mixture of radiolabeled HNF4 and HNF6 is submitted to immunoprecipitation. The protein content of the pellet (P) and supernatant (S) fractions are separated by gel electrophoresis and visualized by exposing the gel to an X-ray film. Before electrophoresis, proteins are denatured to destroy every non-covalent interaction between proteins. On the film diagrammed in this figure, radioactive proteins appear as dark bands

Are these two antibodies specific? Explain.

2) Transcription factors HNF4 and 6 are expressed in liver and pancreas. Genomic DNA from each tissue is carefully purified such that bound proteins remain associated with the DNA. The genomic DNA is then treated with an enzyme that cuts it in small fragments.

The digestion mixture containing the small DNA fragments and their associated proteins is submitted to immunoprecipitation with either -HNF4 or -HNF6.

Which regions of various genes are likely to co-purify with each antibody? Explain.

3) After removal of the associated proteins, the immunoprecipitated DNA fragments are denatured and each strand is labeled with fluorescent molecules. DNA fragments purified by immunoprecipitation with -HNF4 and -HNF6 were labeled with a green and red fluorescent molecule respectively. The fluorescent DNA fragments are hybridized with a DNA array containing 3000 known genomic sequences forming discreet spots on a microchip. The position and identity of each genomic sequence on the microchip is known, and each spotted genomic sequence corresponds to a 500 nucleotides long sequence located immediately upstream of the transcription start of known genes.

a) When the hybridization is performed at 25°C about 1500 spots become fluorescent with either fluorescent probes. A hybridization at 55°C leads to about 500 fluorescent spots. Explain this result.

b) A mixture of single-stranded “green” and “red” fluorescent probes is added to the DNA array, and after hybridization, the fluorescence of each of the spots on the array is analyzed. For any given spot, either no fluorescence, green fluorescence, red fluorescence, or yellow fluorescence is observed. What are the promoter specificities of the spotted genomic DNA that gave rise to the red, green, and yellow spots?

c) Figure 2 shows the typical results of hybridization with DNA fragments immunoprecipitated from liver and pancreas using -HNF4. In this case, Immunoprecipitated DNA fragments from liver are labeled with red fluorescent molecules and those immunoprecipitated from pancreas are labeled with green fluorescent molecules.

Figure 2: After hybridization with fluorescent DNA, the fluorescence of spots 1 to 6 is analyzed. The shape of the spot indicates their colors (red, green or yellow) and spots represented by circles are not fluorescent (NF).

Is the transcription regulation by HNF4 strictly tissue-specific? Explain

4) A similar immunoprecipitation assay is performed on liver with an antibody directed against RNA polymerase II. The Venn diagram (Figure 3) shows the overlap of the set of spotted genomic DNA fragments that hybridize with fluorescent probes obtained only after anti-RNA-PolII and anti-HNF4 immunoprecipitation

Figure 3: Venn diagram showing the number of spots on the DNA array that hybridize with fluorescent probes purified by immunoprecipitation with anti-HNF4 (A) or with anti-RNA Pol II (B) or with both antibodies (C). The sizes of the circles are proportional to the number of hybridized spots

a) Does the relative size of the circles make sense? Explain

b) What is the functional difference between spotted genes in the A and C regions of the Venn diagram?

5) In vitro, HNF4 binds the promoter regions of two distinct genes with the same affinity. However, in cells, one of these two genes is transcribed at a higher rate than the other. What other genetic element(s) might be responsible for this difference in cells?

6) The expression of the transcription factor HNF6 results in an increase of the expression of the

NR1D1

gene. Three sets of fluorescent DNA probes purified by are applied to the DNA arrays. The hybridization of these fluorescent probes with spotted genomic DNA corresponding to the promoter regions of the genes HNF1, HNF4 and NR1D1 are showed in figure 4.

Figure 4: Results of 3 hybridizations with fluorescent DNA fragments purified by immunoprecipitation with anti-HNF6 (left), anti-HNF4 (middle) and anti-HNF1 (right). The names genes whose promoter regions are spotted on the array are indicated on top of each spot. Black circles represent fluorescent spots.

The following diagram (see next page) represents a regulatory chain leading to the transcriptional activation of NR1D1. Each box corresponds to one of the genes described above, and an arrow indicate that the gene on the left side of the arrow activates the transcription of the gene on the right side of the arrow. On the diagram, label each box with the name of the corresponding gene. Explain your reasoning (no credit will be given without an explanation).

NR1D1

Part II

Question 3

Peptide libraries can be created by fusing random peptides at the carboxy-end of a protein expressed inside bacteria. Scientist have developed a method to screen these peptide libraries for peptide ligands that is based on the lac operon.

A. Preparation of a peptide library.

The plasmid (pJS142) used to construct the peptide library is shown in figure 1.

Figure 1: Plasmid pJS42 is characterized by a gene conferring resistance to ampicillin (Ampr), a sequence corresponding to the lac operator (Lac O) that can bind to the lac repressor, the gene coding for the lac repressor (LacI) under the control of the arabinose promoter (araP), and a cloning site (CS) separated from the LacI sequence by a short linker (see Figure 2).

1) The plasmid was linearized using the restriction enzyme SfiI. The cloning site (CS) of pJS142 contains two sequences recognized by SfiI. SfiI binds to and cleaves the following sequence (the sites of cleavage on each strand are indicated by an arrow head):

a) On figure 2, underline the two sequences recognized by SfiI. (1 pts)

Figure 2: The arrows identify the boundaries of the sequence of the LacI (partial), the linker and the cloning site (CS). The corresponding amino acid sequence is listed below the double stranded DNA sequence (upper strand: 5’  3’).

b) Generally, when a double stranded DNA fragment is cloned into a plasmid linearized by a single restriction enzyme, the orientation of the cloned DNA cannot be controlled. In contrast, when the plasmid is digested with SfiI, you can predetermine the orientation of the cloned DNA. Explain. (2 pts)

2) Three oligonucleotides are needed for the construction of the library:

ON-829: 5’- ACC ACC TCC GG-3’ ON-830: 5’- TTA CTT AGT TA-3’

LN (library of nucleotides): 5’- GA GGT GGT {NNK}n TAA CTA AGT AAA GC, where {NNK}n denotes a random region of the desired length ( 3 x n) and sequence. NNK triplets specify random amino acids where N is one of the four nucleotides (A, C, G, or T), and K is either G or T.

a) How many codons a NNK triplet would specify? (1 pts)

b) Why are NNK repeats better than NNN repeats to design a random peptide? (2pts)

3) Cloning procedure

Step 1: 5’-phosphorylated primers ON-829, ON-830, and the library of nucleotides (LN) are mixed together, heated at 70°C for 5 minutes, and slowly cooled down to 4°C.

Step 2: The SfiI-digested plasmid is purified away from the small fragment comprised between the two SfiI restriction sites.

Step 3: The purified and digested plasmid and the cold oligonucleotide mixture are combined and T4 DNA ligase is added.

Step 4: A mixture of dNTPs and a DNA polymerase are added to the ligation reaction. Step 5: The plasmid DNA is then purified and used to transformed bacteria.

a) Represent, in a diagram, the structure of the assembled oligonucleotide complex obtained at the end of step 1. Write the sequence of each oligonucleotide (see above), label each oligonucleotide (including 5’ and 3’) and clearly show the double stranded regions inside the complex. (2 pts)

b) Represent, in a diagram, the sequence of the pJS141 cloning region after digestion with SfiI.

Include in the diagram the sequence coding for lacI, the linker and the sequence downstream of the second SfiI restriction site. (2 pts)

Cloning site before digestion:

GGGCAGGTGGTGCATGGGGAGCAGGTGGGTGGTGAGGCCTCCGGGGCCGTTAACGGCCGTGGCCTAGCTGGCCAATAA CCCGTCCACCACGTACCCCTCGTCCACCCACCACTCCGGAGGCCCCGGCAATTGCCGGCACCGGATCGACCGGTTATT G Q V V H G E Q V G G E A S G A V N G R G L A G Q *

c) Represent, in a diagram, the sequence of the pJS142 cloning site and the oligonucleotide complex after ligation (step 3). (2 pts)

d) Represent, in a diagram, the sequence of the pJS142 cloning site and the oligonucleotide complex after step

4. (2 pts)

e) Why is the 5’-phosphorylation of primers ON-829 and ON-830 necessary? (1 pts)

B. Screening of the plasmid library.

Bacteria transformed with the recombinant plasmid library are grown in the presence of arabinose to trigger the transcription of the LacI gene fused to the cloned random sequence. The recombinant pJS142 plasmid contained into these arabinose-induced bacteria is then purified under experimental conditions that preserve DNA-protein interaction.

In vitro binding assay: The purified recombinant plasmids are then incubated with the protein 70 conjugated to beads and diluted in binding buffer. After centrifugation, the pellet of beads is washed several times and then bound plasmids are eluted and re-transformed into bacteria. This process is repeated several times to obtained a collection of plasmid enriched in plasmid/protein complexes that specifically bind to 70.

1) Based on your knowledge of the Lac operon, explain, in detail, how this method would allow you to identify the sequence of peptides that bind to 70. (6 pts)

2) What would happen if lactose were added to the binding buffer? (2 pts)

3) One of the recombinant pJS142 plasmid was sequenced using a primer that anneals to a region of the LacI non-coding strand. The sequence autoradiogram is shown of figure 3.

Figure 3: Results of the sequencing reaction.

Based on the sequence shown in figure 3, and the sequence of the cloning site after ligation of the random oligonucleotides (check your answer to question A-3-e), determine how many NNK triplets were introduced in the random oligonucleotides. (2pts)